2024-04-26 19:42:00, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001207026 1703 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens POU class 2 homeobox 2 (POU2F2), transcript variant 3, mRNA. ACCESSION NM_001207026 VERSION NM_001207026.1 GI:333360877 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1703) AUTHORS Saglam,A. and Uner,A.H. TITLE Immunohistochemical expression of Mum-1, Oct-2 and Bcl-6 in systemic anaplastic large cell lymphomas JOURNAL Tumori 97 (5), 634-638 (2011) PUBMED 22158496 REMARK GeneRIF: Half of the cases displayed Oct-2 expression (15/30 cases) of systemic anaplastic large-cell lymphoma measured by tissue microarray immunohistochemistry. REFERENCE 2 (bases 1 to 1703) AUTHORS Herbeck,R., Teodorescu Brinzeu,D., Giubelan,M., Lazar,E., Dema,A. and Ionita,H. TITLE B-cell transcription factors Pax-5, Oct-2, BOB.1, Bcl-6, and MUM1 are useful markers for the diagnosis of nodular lymphocyte predominant Hodgkin lymphoma JOURNAL Rom J Morphol Embryol 52 (1), 69-74 (2011) PUBMED 21424034 REMARK GeneRIF: Twenty-two cases of nodular lymphocyte predominant Hodgkin lymphoma were studied for the immunohistochemical expression of Pax-5, Oct-2, BOB.1, Bcl-6 protein and MUM1/IRF-4. REFERENCE 3 (bases 1 to 1703) AUTHORS Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V., Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 4 (bases 1 to 1703) AUTHORS Galetti,M., Alfieri,R.R., Cavazzoni,A., La Monica,S., Bonelli,M., Fumarola,C., Mozzoni,P., De Palma,G., Andreoli,R., Mutti,A., Mor,M., Tiseo,M., Ardizzoni,A. and Petronini,P.G. TITLE Functional characterization of gefitinib uptake in non-small cell lung cancer cell lines JOURNAL Biochem. Pharmacol. 80 (2), 179-187 (2010) PUBMED 20363215 REMARK GeneRIF: Gefitinib may exert an inhibitory effect on the intracellular accumulation of drugs transported by hOCT1 and hOCT2. REFERENCE 5 (bases 1 to 1703) AUTHORS Advani,A.S., Lim,K., Gibson,S., Shadman,M., Jin,T., Copelan,E., Kalaycio,M., Sekeres,M.A., Sobecks,R. and Hsi,E. TITLE OCT-2 expression and OCT-2/BOB.1 co-expression predict prognosis in patients with newly diagnosed acute myeloid leukemia JOURNAL Leuk. Lymphoma 51 (4), 606-612 (2010) PUBMED 20141429 REMARK GeneRIF: OCT-2 may act as a cell survival factor in acute myeloid leukemia by mediating expression of downstream targets, such as BCL-2. REFERENCE 6 (bases 1 to 1703) AUTHORS Muller-Immergluck,M.M., Schaffner,W. and Matthias,P. TITLE Transcription factor Oct-2A contains functionally redundant activating domains and works selectively from a promoter but not from a remote enhancer position in non-lymphoid (HeLa) cells JOURNAL EMBO J. 9 (5), 1625-1634 (1990) PUBMED 2328728 REFERENCE 7 (bases 1 to 1703) AUTHORS Scheidereit,C., Cromlish,J.A., Gerster,T., Kawakami,K., Balmaceda,C.G., Currie,R.A. and Roeder,R.G. TITLE A human lymphoid-specific transcription factor that activates immunoglobulin genes is a homoeobox protein JOURNAL Nature 336 (6199), 551-557 (1988) PUBMED 2904654 REFERENCE 8 (bases 1 to 1703) AUTHORS Muller,M.M., Ruppert,S., Schaffner,W. and Matthias,P. TITLE A cloned octamer transcription factor stimulates transcription from lymphoid-specific promoters in non-B cells JOURNAL Nature 336 (6199), 544-551 (1988) PUBMED 2904653 REFERENCE 9 (bases 1 to 1703) AUTHORS Clerc,R.G., Corcoran,L.M., LeBowitz,J.H., Baltimore,D. and Sharp,P.A. TITLE The B-cell-specific Oct-2 protein contains POU box- and homeo box-type domains JOURNAL Genes Dev. 2 (12A), 1570-1581 (1988) PUBMED 3265124 REFERENCE 10 (bases 1 to 1703) AUTHORS Ko,H.S., Fast,P., McBride,W. and Staudt,L.M. TITLE A human protein specific for the immunoglobulin octamer DNA motif contains a functional homeobox domain JOURNAL Cell 55 (1), 135-144 (1988) PUBMED 2901913 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from M36653.1 and AC022515.5. Summary: The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]. Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (3) is shorter at the C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: M36653.1, X53468.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025089, ERS025095 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1617 M36653.1 5-1621 1618-1618 AC022515.5 1943-1943 1619-1703 M36653.1 1622-1706 FEATURES Location/Qualifiers source 1..1703 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="19" /map="19q13.2" gene 1..1703 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="POU class 2 homeobox 2" /db_xref="GeneID:5452" /db_xref="HGNC:9213" /db_xref="MIM:164176" exon 1..90 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" misc_feature 24..26 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="upstream in-frame stop codon" variation complement(33) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:371039226" variation complement(61) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:373375555" CDS 63..1466 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="isoform 3 is encoded by transcript variant 3; POU domain, class 2, transcription factor 2; homeobox protein; OTF-2; octamer-binding protein 2; octamer-binding transcription factor 2; lymphoid-restricted immunoglobulin octamer-binding protein NF-A2" /codon_start=1 /product="POU domain, class 2, transcription factor 2 isoform 3" /protein_id="NP_001193955.1" /db_xref="GI:333360878" /db_xref="CCDS:CCDS56094.1" /db_xref="GeneID:5452" /db_xref="HGNC:9213" /db_xref="MIM:164176" /translation="
MVHSSMGAPEIRMSKPLEAEKQGLDSPSEHTDTERNGPDTNHQNPQNKTSPFSVSPTGPSTKIKAEDPSGDSAPAAPLPPQPAQPHLPQAQLMLTGSQLAGDIQQLLQLQQLVLVPGHHLQPPAQFLLPQAQQSQPGLLPTPNLFQLPQQTQGALLTSQPRAGLPTQAVTRPTLPDPHLSHPQPPKCLEPPSHPEEPSDLEELEQFARTFKQRRIKLGFTQGDVGLAMGKLYGNDFSQTTISRFEALNLSFKNMCKLKPLLEKWLNDAETMSVDSSLPSPNQLSSPSLGFDGLPGRRRKKRTSIETNVRFALEKSFLANQKPTSEEILLIAEQLHMEKEVIRVWFCNRRQKEKRINPCSAAPMLPSPGKPASYSPHMVTPQGGAGTLPLSQASSSLSTTVTTLSSAVGTLHPSRTAGGGGGGGGAAPPLNSIPSVTPPPPATTNSTNPSPQGSHSAIGLSGLNPSTG
" misc_feature 645..869 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="Found in Pit-Oct-Unc transcription factors; Region: POU; smart00352" /db_xref="CDD:197673" misc_feature 954..1124 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(954..968,972..974,1023..1025,1041..1043,1080..1082, 1086..1091,1098..1103,1107..1115,1119..1124) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(960..962,969..971,1089..1091,1098..1103,1110..1112) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 1227..1292 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P09086.3); Region: Leucine-zipper" variation complement(83) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="g" /db_xref="dbSNP:201035439" exon 91..156 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(103) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:202021860" variation complement(119) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:145518520" variation complement(135) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:149684085" variation complement(142) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:140322079" variation complement(143) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="t" /db_xref="dbSNP:373677672" exon 157..191 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" exon 192..248 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(208) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:372088467" variation complement(231) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:373198280" variation complement(235) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:147555913" exon 249..365 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(264) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:113697394" variation complement(265) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="g" /db_xref="dbSNP:145313361" variation complement(282) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:369000179" variation complement(339) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:139761991" variation complement(346) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:150784596" variation complement(363) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:113689861" exon 366..471 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(425) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:376769120" variation complement(463) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:141261459" exon 472..563 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(479) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:148654132" variation complement(482) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:375042716" variation complement(492) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:200919726" variation complement(526) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:144295200" variation complement(549) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:142832761" exon 564..725 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(607) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:371631003" variation complement(616) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:200544374" STS 617..856 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /standard_name="POU2F2" /db_xref="UniSTS:253999" exon 726..867 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(812) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:138243265" exon 868..1016 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(871) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:373127616" variation complement(899) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:145633555" variation complement(922) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="g" /db_xref="dbSNP:369381206" variation complement(927) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:368762837" variation complement(947) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:375184543" variation complement(962) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:373724008" exon 1017..1193 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(1047) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:142293929" variation complement(1073) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:374063683" variation complement(1097) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:369799078" variation complement(1142) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:192872020" exon 1194..1260 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(1213) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:200445754" variation complement(1220) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="g" /db_xref="dbSNP:372373896" variation complement(1226) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:375995375" exon 1261..1703 /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /inference="alignment:Splign:1.39.8" variation complement(1381) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:185988799" variation complement(1426) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:377011370" variation complement(1433) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:372097777" variation complement(1438..1439) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="" /replace="tt" /db_xref="dbSNP:371927380" variation complement(1439) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="g" /replace="t" /db_xref="dbSNP:367613289" variation complement(1477) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:367932052" variation complement(1504) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="c" /replace="t" /db_xref="dbSNP:202163562" variation complement(1505) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:376651765" variation complement(1627) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:78816499" variation complement(1654) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:181004153" variation complement(1681) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="g" /db_xref="dbSNP:371886208" variation complement(1692) /gene="POU2F2" /gene_synonym="Oct-2; OCT2; OTF2" /replace="a" /replace="c" /db_xref="dbSNP:142827647" ORIGIN
ggcccccagagagggtggggagatgacacagttgttcccccagccctggcggggcgggcagcatggttcactccagcatgggggctccagaaataagaatgtctaagcccctggaggccgagaagcaaggtctggactccccatcagagcacacagacaccgaaagaaatggaccagacactaatcatcagaacccccaaaataagacctccccattctccgtgtccccaactggccccagtacaaagatcaaggctgaagaccccagtggcgattcagccccagcagcacccctgccccctcagccggcccagcctcatctgccccaggcccaactcatgttgacgggcagccagctagctggggacatacagcagctcctccagctccagcagctggtgcttgtgccaggccaccacctccagccacctgctcagttcctgctaccgcaggcccagcagagccagccaggcctgctaccgacaccaaatctattccagctacctcagcaaacccagggagctcttctgacctcccagccccgggccgggcttcccacacaggccgtgacccgccctacgctgcccgacccgcacctctcgcacccgcagccccccaaatgcttggagccaccatcccaccccgaggagcccagtgatctggaggagctggagcaattcgcccgcaccttcaagcaacgccgcatcaagctgggcttcacgcagggtgatgtgggcctggccatgggcaagctctacggcaacgacttcagccagacgaccatttcccgcttcgaggccctcaacctgagcttcaagaacatgtgcaaactcaagcccctcctggagaagtggctcaacgatgcagagactatgtctgtggactcaagcctgcccagccccaaccagctgagcagccccagcctgggtttcgacggcctgcccggccggagacgcaagaagaggaccagcatcgagacaaacgtccgcttcgccttagagaagagttttctagcgaaccagaagcctacctcagaggagatcctgctgatcgccgagcagctgcacatggagaaggaagtgatccgcgtctggttctgcaaccggcgccagaaggagaaacgcatcaacccctgcagtgcggcccccatgctgcccagcccagggaagccggccagctacagcccccatatggtcacaccccaagggggcgcggggaccttaccgttgtcccaagcttccagcagtctgagcacaacagttactaccttatcctcagctgtggggacgctccaccccagccggacagctggagggggtgggggcgggggcggggctgcgccccccctcaattccatcccctctgtcactcccccacccccggccaccaccaacagcacaaaccccagccctcaaggcagccactcggctatcggcttgtcaggcctgaaccccagcacggggtaagtgggtgcacgtgggaagctgtggggagaagcagggtcgctgctgcttctagggtggggagcggcaccccagttatgttggcaggtccctgcccctgctaatgcctctgctttgcctcttgcagaagcacaatggtggggttgagctccgggctgagtccagccctcatgagcaacaaccctttggccactatccaaggtgcgtgctgcctcatgtcacacccatcgtcaccagccc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5452 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:5452 -> Molecular function: GO:0019904 [protein domain specific binding] evidence: IEA GeneID:5452 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IDA GeneID:5452 -> Biological process: GO:0002335 [mature B cell differentiation] evidence: IEA GeneID:5452 -> Biological process: GO:0002380 [immunoglobulin secretion involved in immune response] evidence: IEA GeneID:5452 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS GeneID:5452 -> Biological process: GO:0006959 [humoral immune response] evidence: TAS GeneID:5452 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IEA GeneID:5452 -> Biological process: GO:0048469 [cell maturation] evidence: IEA GeneID:5452 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:5452 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.