Home |
Help |
Advanced search
2024-04-19 23:25:10, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001146 4338 bp mRNA linear PRI 15-JUL-2013
DEFINITION Homo sapiens angiopoietin 1 (ANGPT1), transcript variant 1, mRNA.
ACCESSION NM_001146
VERSION NM_001146.3 GI:21328452
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4338)
AUTHORS Yamakawa,D., Kidoya,H., Sakimoto,S., Jia,W., Naito,H. and
Takakura,N.
TITLE Ligand-independent Tie2 dimers mediate kinase activity stimulated
by high dose angiopoietin-1
JOURNAL J. Biol. Chem. 288 (18), 12469-12477 (2013)
PUBMED 23504320
REMARK GeneRIF: ligand-independent dimerization of Tie2 is essential for a
strong response upon stimulation with high dose Ang1.
REFERENCE 2 (bases 1 to 4338)
AUTHORS Yu,X., Seegar,T.C., Dalton,A.C., Tzvetkova-Robev,D., Goldgur,Y.,
Rajashankar,K.R., Nikolov,D.B. and Barton,W.A.
TITLE Structural basis for angiopoietin-1-mediated signaling initiation
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (18), 7205-7210 (2013)
PUBMED 23592718
REMARK GeneRIF: the crystal structures of Ang1 both unbound and in complex
with the Tie2 ectodomain, are presented.
REFERENCE 3 (bases 1 to 4338)
AUTHORS Boscolo,E., Mulliken,J.B. and Bischoff,J.
TITLE Pericytes from infantile hemangioma display proangiogenic
properties and dysregulated angiopoietin-1
JOURNAL Arterioscler. Thromb. Vasc. Biol. 33 (3), 501-509 (2013)
PUBMED 23288163
REMARK GeneRIF: Preicytes isolated from infantile hemangioma exhibited
proangiogenic properties and produced low levels of angiopoietin 1.
REFERENCE 4 (bases 1 to 4338)
AUTHORS Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
TITLE Loci associated with N-glycosylation of human immunoglobulin G show
pleiotropy with autoimmune diseases and haematological cancers
JOURNAL PLoS Genet. 9 (1), E1003225 (2013)
PUBMED 23382691
REFERENCE 5 (bases 1 to 4338)
AUTHORS Choi,J.S., Kwak,K.A., Park,M.J., Kim,Y.H., Gil,H.W., Song,H.Y. and
Hong,S.Y.
TITLE Ratio of angiopoietin-2 to angiopoietin-1 predicts mortality in
acute lung injury induced by paraquat
JOURNAL Med. Sci. Monit. 19, 28-33 (2013)
PUBMED 23302768
REMARK GeneRIF: The Ang-2: Ang-1 ratio was significantly higher in the
early death group (2.41 +/- 2.54) than in the survivors (0.90 +/-
0.49) and the late death group (1.33 +/- 0.64).
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 4338)
AUTHORS Ristimaki,A., Narko,K., Enholm,B., Joukov,V. and Alitalo,K.
TITLE Proinflammatory cytokines regulate expression of the lymphatic
endothelial mitogen vascular endothelial growth factor-C
JOURNAL J. Biol. Chem. 273 (14), 8413-8418 (1998)
PUBMED 9525952
REFERENCE 7 (bases 1 to 4338)
AUTHORS Maisonpierre,P.C., Suri,C., Jones,P.F., Bartunkova,S.,
Wiegand,S.J., Radziejewski,C., Compton,D., McClain,J.,
Aldrich,T.H., Papadopoulos,N., Daly,T.J., Davis,S., Sato,T.N. and
Yancopoulos,G.D.
TITLE Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo
angiogenesis
JOURNAL Science 277 (5322), 55-60 (1997)
PUBMED 9204896
REFERENCE 8 (bases 1 to 4338)
AUTHORS Suri,C., Jones,P.F., Patan,S., Bartunkova,S., Maisonpierre,P.C.,
Davis,S., Sato,T.N. and Yancopoulos,G.D.
TITLE Requisite role of angiopoietin-1, a ligand for the TIE2 receptor,
during embryonic angiogenesis
JOURNAL Cell 87 (7), 1171-1180 (1996)
PUBMED 8980224
REFERENCE 9 (bases 1 to 4338)
AUTHORS Davis,S., Aldrich,T.H., Jones,P.F., Acheson,A., Compton,D.L.,
Jain,V., Ryan,T.E., Bruno,J., Radziejewski,C., Maisonpierre,P.C.
and Yancopoulos,G.D.
TITLE Isolation of angiopoietin-1, a ligand for the TIE2 receptor, by
secretion-trap expression cloning
JOURNAL Cell 87 (7), 1161-1169 (1996)
PUBMED 8980223
REFERENCE 10 (bases 1 to 4338)
AUTHORS Ruegg,C. and Pytela,R.
TITLE Sequence of a human transcript expressed in T-lymphocytes and
encoding a fibrinogen-like protein
JOURNAL Gene 160 (2), 257-262 (1995)
PUBMED 7642106
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from D13628.2, AL700429.1 and
AW069541.1.
This sequence is a reference standard in the RefSeqGene project.
On Jun 7, 2002 this sequence version replaced gi:20532339.
Summary: Angiopoietins are proteins with important roles in
vascular development and angiogenesis. All angiopoietins bind with
similar affinity to an endothelial cell-specific tyrosine-protein
kinase receptor. The protein encoded by this gene is a secreted
glycoprotein that activates the receptor by inducing its tyrosine
phosphorylation. It plays a critical role in mediating reciprocal
interactions between the endothelium and surrounding matrix and
mesenchyme and inhibits endothelial permeability. The protein also
contributes to blood vessel maturation and stability, and may be
involved in early development of the heart. Alternative splicing
results in multiple transcript variants encoding distinct
isoforms.[provided by RefSeq, Dec 2010].
Transcript Variant: This variant (1) represents the longer
transcript and encodes the longer isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BX648814.1, BC152411.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..4338
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q23.1"
gene 1..4338
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="angiopoietin 1"
/db_xref="GeneID:284"
/db_xref="HGNC:484"
/db_xref="HPRD:03392"
/db_xref="MIM:601667"
exon 1..765
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
misc_feature 388..390
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="upstream in-frame stop codon"
CDS 469..1965
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="isoform 1 precursor is encoded by transcript
variant 1; ANG-1"
/codon_start=1
/product="angiopoietin-1 isoform 1 precursor"
/protein_id="NP_001137.2"
/db_xref="GI:20532340"
/db_xref="CCDS:CCDS6306.1"
/db_xref="GeneID:284"
/db_xref="HGNC:484"
/db_xref="HPRD:03392"
/db_xref="MIM:601667"
/translation="
MTVFLSFAFLAAILTHIGCSNQRRSPENSGRRYNRIQHGQCAYTFILPEHDGNCRESTTDQYNTNALQRDAPHVEPDFSSQKLQHLEHVMENYTQWLQKLENYIVENMKSEMAQIQQNAVQNHTATMLEIGTSLLSQTAEQTRKLTDVETQVLNQTSRLEIQLLENSLSTYKLEKQLLQQTNEILKIHEKNSLLEHKILEMEGKHKEELDTLKEEKENLQGLVTRQTYIIQELEKQLNRATTNNSVLQKQQLELMDTVHNLVNLCTKEGVLLKGGKREEEKPFRDCADVYQAGFNKSGIYTIYINNMPEPKKVFCNMDVNGGGWTVIQHREDGSLDFQRGWKEYKMGFGNPSGEYWLGNEFIFAITSQRQYMLRIELMDWEGNRAYSQYDRFHIGNEKQNYRLYLKGHTGTAGKQSSLILHGADFSTKDADNDNCMCKCALMLTGGWWFDACGPSNLNGMFYTAGQNHGKLNGIKWHYFKGPSYSLRSTTMMIRPLDF
"
sig_peptide 469..528
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 1309..1956
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="Fibrinogen-related domains (FReDs); C terminal
globular domain of fibrinogen. Fibrinogen is involved in
blood clotting, being activated by thrombin to assemble
into fibrin clots. The N-termini of 2 times 3 chains come
together to form a globular...; Region: FReD; cd00087"
/db_xref="CDD:28971"
misc_feature 1672..1674
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="gamma-gamma dimer interface [polypeptide binding];
other site"
/db_xref="CDD:28971"
misc_feature order(1759..1761,1765..1767,1771..1773)
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28971"
misc_feature order(1783..1785,1792..1797,1822..1827)
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/note="polymerization pocket; other site"
/db_xref="CDD:28971"
STS 751..1331
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/standard_name="Agpt"
/db_xref="UniSTS:166624"
exon 766..921
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
exon 922..1043
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
exon 1044..1276
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
exon 1277..1404
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
STS 1287..1744
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/standard_name="Angpt1"
/db_xref="UniSTS:471085"
exon 1405..1506
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
exon 1507..1673
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
exon 1674..1804
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
exon 1805..4338
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/inference="alignment:Splign:1.39.8"
variation 2269..2314
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:45624134"
variation 2914
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1954727"
variation 3187
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:41322349"
variation 3334..3379
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="a"
/replace="t"
/db_xref="dbSNP:45532734"
STS 3549..3685
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/standard_name="RH25244"
/db_xref="UniSTS:16614"
variation 3564
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="a"
/replace="g"
/db_xref="dbSNP:41343148"
variation 3621..3666
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:45545232"
variation 3666
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="c"
/replace="t"
/db_xref="dbSNP:41364248"
variation 3674
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="a"
/replace="c"
/db_xref="dbSNP:41421548"
variation 3786
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="g"
/replace="t"
/db_xref="dbSNP:41415945"
STS 3860..4101
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/standard_name="RH17369"
/db_xref="UniSTS:81911"
variation 4164..4208
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace=""
/replace="cattt"
/db_xref="dbSNP:45614542"
variation 4200..4240
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace="c"
/replace="g"
/db_xref="dbSNP:45517437"
variation 4205..4206
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/replace=""
/replace="tttca"
/db_xref="dbSNP:41516446"
polyA_signal 4311..4316
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
polyA_site 4338
/gene="ANGPT1"
/gene_synonym="AGP1; AGPT; ANG1"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
ggggcacactcatgcattcctgtcaagtcatcttgtgaaaggctgcctgcttccagcttggcttggatgtgcaaccttaataaaactcactgaggtctgggagaaaatagcagatctgcagcagatagggtagaggaaagggtctagaatatgtacacgcagctgactcaggcaggctccatgctgaacggtcacacagagaggaaacaataaatctcagctactatgcaataaatatctcaagttttaacgaagaaaaacatcattgcagtgaaataaaaaattttaaaattttagaacaaagctaacaaatggctagttttctatgattcttcttcaaacgctttctttgagggggaaagagtcaaacaaacaagcagttttacctgaaataaagaactagttttagaggtcagaagaaaggagcaagttttgcgagaggcacggaaggagtgtgctggcagtacaatgacagttttcctttcctttgctttcctcgctgccattctgactcacatagggtgcagcaatcagcgccgaagtccagaaaacagtgggagaagatataaccggattcaacatgggcaatgtgcctacactttcattcttccagaacacgatggcaactgtcgtgagagtacgacagaccagtacaacacaaacgctctgcagagagatgctccacacgtggaaccggatttctcttcccagaaacttcaacatctggaacatgtgatggaaaattatactcagtggctgcaaaaacttgagaattacattgtggaaaacatgaagtcggagatggcccagatacagcagaatgcagttcagaaccacacggctaccatgctggagataggaaccagcctcctctctcagactgcagagcagaccagaaagctgacagatgttgagacccaggtactaaatcaaacttctcgacttgagatacagctgctggagaattcattatccacctacaagctagagaagcaacttcttcaacagacaaatgaaatcttgaagatccatgaaaaaaacagtttattagaacataaaatcttagaaatggaaggaaaacacaaggaagagttggacaccttaaaggaagagaaagagaaccttcaaggcttggttactcgtcaaacatatataatccaggagctggaaaagcaattaaacagagctaccaccaacaacagtgtccttcagaagcagcaactggagctgatggacacagtccacaaccttgtcaatctttgcactaaagaaggtgttttactaaagggaggaaaaagagaggaagagaaaccatttagagactgtgcagatgtatatcaagctggttttaataaaagtggaatctacactatttatattaataatatgccagaacccaaaaaggtgttttgcaatatggatgtcaatgggggaggttggactgtaatacaacatcgtgaagatggaagtctagatttccaaagaggctggaaggaatataaaatgggttttggaaatccctccggtgaatattggctggggaatgagtttatttttgccattaccagtcagaggcagtacatgctaagaattgagttaatggactgggaagggaaccgagcctattcacagtatgacagattccacataggaaatgaaaagcaaaactataggttgtatttaaaaggtcacactgggacagcaggaaaacagagcagcctgatcttacacggtgctgatttcagcactaaagatgctgataatgacaactgtatgtgcaaatgtgccctcatgttaacaggaggatggtggtttgatgcttgtggcccctccaatctaaatggaatgttctatactgcgggacaaaaccatggaaaactgaatgggataaagtggcactacttcaaagggcccagttactccttacgttccacaactatgatgattcgacctttagatttttgaaagcgcaatgtcagaagcgattatgaaagcaacaaagaaatccggagaagctgccaggtgagaaactgtttgaaaacttcagaagcaaacaatattgtctcccttccagcaataagtggtagttatgtgaagtcaccaaggttcttgaccgtgaatctggagccgtttgagttcacaagagtctctacttggggtgacagtgctcacgtggctcgactatagaaaactccactgactgtcgggctttaaaaagggaagaaactgctgagcttgctgtgcttcaaactactactggaccttattttggaactatggtagccagatgataaatatggttaatttcatgtaaaacagaaaaaaagagtgaaaaagagaatatacatgaagaatagaaacaagcctgccataatcctttggaaaagatgtattataccagtgaaaaggtgttatatctatgcaaacctactaacaaattatactgttgcacaattttgataaaaatttagaacagcattgtcctctgagttggttaaatgttaatggatttcagaagcctaattccagtatcatacttactagttgatttctgcttacccatcttcaaatgaaaattccatttttgtaagccataatgaactgtagtacatggacaataagtgtgtggtagaaacaaactccattactctgatttttgatacagttttcagaaaaagaaatgaacataatcaagtaaggatgtatgtggtgaaaacttaccacccccatactatggttttcatttactctaaaaactgattgaatgatatataaatatatttatagcctgagtaaagttaaaagaatgtaaaatatatcatcaagttcttaaaataatatacatgcatttaatatttcctttgatattatacaggaaagcaatattttggagtatgttaagttgaagtaaaagcaagtactctggagcagttcattttacagtatctacttgcatgtgtatacatacatgtaacttcattattttaaaaatatttttagaactccaatactcaccctgttatgtcttgctaatttaaattttgctaattaactgaaacatgcttaccagattcacactgttccagtgtctataaaagaaacactttgaagtctataaaaaataaaataattataaatatcattgtacatagcatgtttatatctgcaaaaaacctaatagctaattaatctggaatatgcaacattgtccttaattgatgcaaataacacaaatgctcaaagaaatctactatatcccttaatgaaatacatcattcttcatatatttctccttcagtccattcccttaggcaatttttaatttttaaaaattattatcaggggagaaaaattggcaaaactattatatgtaagggaaatatatacaaaaagaaaattaatcatagtcacctgactaagaaattctgactgctagttgccataaataactcaatggaaatattcctatgggataatgtattttaagtgaatttttggggtgcttgaagttactgcattattttatcaagaagtcttctctgcctgtaagtgtccaaggttatgacagtaaacagtttttattaaaacatgagtcactatgggatgagaaaattgaaataaagctactgggcctcctctcataaaagagacagttgttggcaaggtagcaataccagtttcaaacttggtgacttgatccactatgccttaatggtttcctccatttgagaaaataaagctattcacattgttaagaaaaatactttttaaagtttaccatcaagtcttttttatatttatgtgtctgtattctacccctttttgccttacaagtgatatttgcaggtattataccatttttctattcttggtggcttcttcatagcaggtaagcctctccttctaaaaacttctcaactgttttcatttaagggaaagaaaatgagtattttgtccttttgtgttcctacagacactttcttaaaccagtttttggataaagaatactatttccaaactcatattacaaaaacaaaataaaataataaaaaaagaaagcatgatatttactgttttgttgtctgggtttgagaaatgaaatattgtttccaattatttataataaatcagtataaaatgttttatgattgttatgtgtattatgtaatacgtacatgtttatggcaatttaacatgtgtattcttttaattgtttcagaataggataattaggtattcgaattttgtctttaaaattcatgtggtttctatgcaaagttcttcatatcatcacaacattatttgatttaaataaaattgaaagtaatatttgtgcaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:284 -> Molecular function: GO:0030971 [receptor tyrosine kinase binding] evidence: IPI
GeneID:284 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
GeneID:284 -> Biological process: GO:0001936 [regulation of endothelial cell proliferation] evidence: IDA
GeneID:284 -> Biological process: GO:0002040 [sprouting angiogenesis] evidence: IDA
GeneID:284 -> Biological process: GO:0002092 [positive regulation of receptor internalization] evidence: IDA
GeneID:284 -> Biological process: GO:0007162 [negative regulation of cell adhesion] evidence: IDA
GeneID:284 -> Biological process: GO:0007171 [activation of transmembrane receptor protein tyrosine kinase activity] evidence: IDA
GeneID:284 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
GeneID:284 -> Biological process: GO:0010595 [positive regulation of endothelial cell migration] evidence: IDA
GeneID:284 -> Biological process: GO:0014068 [positive regulation of phosphatidylinositol 3-kinase cascade] evidence: IEA
GeneID:284 -> Biological process: GO:0014842 [regulation of satellite cell proliferation] evidence: IDA
GeneID:284 -> Biological process: GO:0030097 [hemopoiesis] evidence: IEA
GeneID:284 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
GeneID:284 -> Biological process: GO:0030210 [heparin biosynthetic process] evidence: IDA
GeneID:284 -> Biological process: GO:0031398 [positive regulation of protein ubiquitination] evidence: IDA
GeneID:284 -> Biological process: GO:0031589 [cell-substrate adhesion] evidence: IEA
GeneID:284 -> Biological process: GO:0033138 [positive regulation of peptidyl-serine phosphorylation] evidence: IEA
GeneID:284 -> Biological process: GO:0034394 [protein localization to cell surface] evidence: IDA
GeneID:284 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IDA
GeneID:284 -> Biological process: GO:0043116 [negative regulation of vascular permeability] evidence: IDA
GeneID:284 -> Biological process: GO:0043536 [positive regulation of blood vessel endothelial cell migration] evidence: IDA
GeneID:284 -> Biological process: GO:0045785 [positive regulation of cell adhesion] evidence: IEA
GeneID:284 -> Biological process: GO:0048014 [Tie signaling pathway] evidence: IDA
GeneID:284 -> Biological process: GO:0050731 [positive regulation of peptidyl-tyrosine phosphorylation] evidence: IDA
GeneID:284 -> Biological process: GO:0050900 [leukocyte migration] evidence: TAS
GeneID:284 -> Biological process: GO:0050918 [positive chemotaxis] evidence: IDA
GeneID:284 -> Biological process: GO:0051897 [positive regulation of protein kinase B signaling cascade] evidence: IDA
GeneID:284 -> Biological process: GO:0070374 [positive regulation of ERK1 and ERK2 cascade] evidence: IDA
GeneID:284 -> Biological process: GO:0072012 [glomerulus vasculature development] evidence: ISS
GeneID:284 -> Biological process: GO:2000352 [negative regulation of endothelial cell apoptotic process] evidence: IDA
GeneID:284 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:284 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
GeneID:284 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:284 -> Cellular component: GO:0005902 [microvillus] evidence: IDA
GeneID:284 -> Cellular component: GO:0045121 [membrane raft] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.