Home |
Help |
Advanced search
2024-04-17 05:26:20, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001136025 3327 bp mRNA linear PRI 01-JUL-2013
DEFINITION Homo sapiens plastin 3 (PLS3), transcript variant 2, mRNA.
ACCESSION NM_001136025
VERSION NM_001136025.3 GI:288915540
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3327)
AUTHORS Yokobori,T., Iinuma,H., Shimamura,T., Imoto,S., Sugimachi,K.,
Ishii,H., Iwatsuki,M., Ota,D., Ohkuma,M., Iwaya,T., Nishida,N.,
Kogo,R., Sudo,T., Tanaka,F., Shibata,K., Toh,H., Sato,T.,
Barnard,G.F., Fukagawa,T., Yamamoto,S., Nakanishi,H., Sasaki,S.,
Miyano,S., Watanabe,T., Kuwano,H., Mimori,K., Pantel,K. and Mori,M.
TITLE Plastin3 is a novel marker for circulating tumor cells undergoing
the epithelial-mesenchymal transition and is associated with
colorectal cancer prognosis
JOURNAL Cancer Res. 73 (7), 2059-2069 (2013)
PUBMED 23378342
REMARK GeneRIF: Overexpression of PLS3 is associated with
epithelial-mesenchymal transition and is associated with metastasis
in colorectal cancer
REFERENCE 2 (bases 1 to 3327)
AUTHORS Michel,L., Jean-Louis,F., Begue,E., Bensussan,A. and Bagot,M.
TITLE Use of PLS3, Twist, CD158k/KIR3DL2, and NKp46 gene expression
combination for reliable Sezary syndrome diagnosis
JOURNAL Blood 121 (8), 1477-1478 (2013)
PUBMED 23429988
REMARK GeneRIF: PLS3, Twist, KIR3DL2 and NKp46 gene expression can model
efficient molecular Sezary syndrome diagnosis.
REFERENCE 3 (bases 1 to 3327)
AUTHORS Su,H., Zhu,J., Cai,C., Pei,W., Wang,J., Dong,H. and Ren,H.
TITLE FIMBRIN1 is involved in lily pollen tube growth by stabilizing the
actin fringe
JOURNAL Plant Cell 24 (11), 4539-4554 (2012)
PUBMED 23150633
REFERENCE 4 (bases 1 to 3327)
AUTHORS Jones,C.L., Ferreira,S., McKenzie,R.C., Tosi,I., Caesar,J.A.,
Bagot,M., Whittaker,S.J. and Mitchell,T.J.
TITLE Regulation of T-plastin expression by promoter hypomethylation in
primary cutaneous T-cell lymphoma
JOURNAL J. Invest. Dermatol. 132 (8), 2042-2049 (2012)
PUBMED 22495182
REMARK GeneRIF: PLS3 is expressed in the majority of SS patients and
provide insight into the molecular regulation of PLS3 expression in
CTCL
REFERENCE 5 (bases 1 to 3327)
AUTHORS Begue,E., Jean-Louis,F., Bagot,M., Jauliac,S., Cayuela,J.M.,
Laroche,L., Parquet,N., Bachelez,H., Bensussan,A., Courtois,G. and
Michel,L.
TITLE Inducible expression and pathophysiologic functions of T-plastin in
cutaneous T-cell lymphoma
JOURNAL Blood 120 (1), 143-154 (2012)
PUBMED 22627769
REMARK GeneRIF: T-plastin is a marker restricted to malignant lymphocytes
from Sezary syndrome patients and plays a role for cell survival
and migration.
REFERENCE 6 (bases 1 to 3327)
AUTHORS Arpin,M., Friederich,E., Algrain,M., Vernel,F. and Louvard,D.
TITLE Functional differences between L- and T-plastin isoforms
JOURNAL J. Cell Biol. 127 (6 PT 2), 1995-2008 (1994)
PUBMED 7806577
REFERENCE 7 (bases 1 to 3327)
AUTHORS Lin,C.S., Park,T., Chen,Z.P. and Leavitt,J.
TITLE Human plastin genes. Comparative gene structure, chromosome
location, and differential expression in normal and neoplastic
cells
JOURNAL J. Biol. Chem. 268 (4), 2781-2792 (1993)
PUBMED 8428952
REFERENCE 8 (bases 1 to 3327)
AUTHORS Lin,C.S., Aebersold,R.H. and Leavitt,J.
TITLE Correction of the N-terminal sequences of the human plastin
isoforms by using anchored polymerase chain reaction:
identification of a potential calcium-binding domain
JOURNAL Mol. Cell. Biol. 10 (4), 1818-1821 (1990)
PUBMED 2378651
REFERENCE 9 (bases 1 to 3327)
AUTHORS Lin,C.S., Aebersold,R.H., Kent,S.B., Varma,M. and Leavitt,J.
TITLE Molecular cloning and characterization of plastin, a human
leukocyte protein expressed in transformed human fibroblasts
JOURNAL Mol. Cell. Biol. 8 (11), 4659-4668 (1988)
PUBMED 3211125
REFERENCE 10 (bases 1 to 3327)
AUTHORS Goldstein,D., Djeu,J., Latter,G., Burbeck,S. and Leavitt,J.
TITLE Abundant synthesis of the transformation-induced protein of
neoplastic human fibroblasts, plastin, in normal lymphocytes
JOURNAL Cancer Res. 45 (11 PT 2), 5643-5647 (1985)
PUBMED 4053036
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DC357886.1, BC039049.1 and
AC005000.2.
On Feb 17, 2010 this sequence version replaced gi:226053520.
Summary: Plastins are a family of actin-binding proteins that are
conserved throughout eukaryote evolution and expressed in most
tissues of higher eukaryotes. In humans, two ubiquitous plastin
isoforms (L and T) have been identified. Plastin 1 (otherwise known
as Fimbrin) is a third distinct plastin isoform which is
specifically expressed at high levels in the small intestine. The L
isoform is expressed only in hemopoietic cell lineages, while the T
isoform has been found in all other normal cells of solid tissues
that have replicative potential (fibroblasts, endothelial cells,
epithelial cells, melanocytes, etc.). The C-terminal 570 amino
acids of the T-plastin and L-plastin proteins are 83% identical. It
contains a potential calcium-binding site near the N terminus.
Alternate splicing results in multiple transcript
variants.[provided by RefSeq, Feb 2010].
Transcript Variant: This variant (2) differs in the 5' UTR compared
to variant 1. Variants 1 and 2 encode the same isoform (1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC039049.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025083 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-101 DC357886.1 1-101
102-3138 BC039049.1 1-3037
3139-3327 AC005000.2 19038-19226
FEATURES Location/Qualifiers
source 1..3327
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq23"
gene 1..3327
/gene="PLS3"
/gene_synonym="T-plastin"
/note="plastin 3"
/db_xref="GeneID:5358"
/db_xref="HGNC:9091"
/db_xref="MIM:300131"
exon 1..126
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 9
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:12847396"
variation 92
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:370675011"
exon 127..207
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
misc_feature 132..134
/gene="PLS3"
/gene_synonym="T-plastin"
/note="upstream in-frame stop codon"
CDS 135..2027
/gene="PLS3"
/gene_synonym="T-plastin"
/note="isoform 1 is encoded by transcript variant 2; T
fimbrin; plastin-3; T plastin"
/codon_start=1
/product="plastin-3 isoform 1"
/protein_id="NP_001129497.1"
/db_xref="GI:209862851"
/db_xref="CCDS:CCDS14568.1"
/db_xref="GeneID:5358"
/db_xref="HGNC:9091"
/db_xref="MIM:300131"
/translation="
MDEMATTQISKDELDELKEAFAKVDLNSNGFICDYELHELFKEANMPLPGYKVREIIQKLMLDGDRNKDGKISFDEFVYIFQEVKSSDIAKTFRKAINRKEGICALGGTSELSSEGTQHSYSEEEKYAFVNWINKALENDPDCRHVIPMNPNTDDLFKAVGDGIVLCKMINLSVPDTIDERAINKKKLTPFIIQENLNLALNSASAIGCHVVNIGAEDLRAGKPHLVLGLLWQIIKIGLFADIELSRNEALAALLRDGETLEELMKLSPEELLLRWANFHLENSGWQKINNFSADIKDSKAYFHLLNQIAPKGQKEGEPRIDINMSGFNETDDLKRAESMLQQADKLGCRQFVTPADVVSGNPKLNLAFVANLFNKYPALTKPENQDIDWTLLEGETREERTFRNWMNSLGVNPHVNHLYADLQDALVILQLYERIKVPVDWSKVNKPPYPKLGANMKKLENCNYAVELGKHPAKFSLVGIGGQDLNDGNQTLTLALVWQLMRRYTLNVLEDLGDGQKANDDIIVNWVNRTLSEAGKSTSIQSFKDKTISSSLAVVDLIDAIQPGCINYDLVKSGNLTEDDKHNNAKYAVSMARRIGARVYALPEDLVEVKPKMVMTVFACLMGRGMKRV
"
misc_feature 180..380
/gene="PLS3"
/gene_synonym="T-plastin"
/note="EF-hand, calcium binding motif; A diverse
superfamily of calcium sensors and calcium signal
modulators; most examples in this alignment model have 2
active canonical EF hands. Ca2+ binding induces a
conformational change in the EF-hand motif, leading to...;
Region: EFh; cd00051"
/db_xref="CDD:28933"
misc_feature 189..2003
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Ca2+-binding actin-bundling protein fimbrin/plastin
(EF-Hand superfamily) [Cytoskeleton]; Region: SAC6;
COG5069"
/db_xref="CDD:34673"
misc_feature order(207..209,213..215,219..221,240..242,327..329,
333..335,339..341,360..362)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:28933"
misc_feature 504..851
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(504..509,513..521,528..530,537..539,735..740,
747..749,756..758,762..764,807..812,819..824,828..833,
840..845)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 936..1268
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(936..941,945..953,960..962,969..971,1155..1160,
1167..1169,1176..1178,1182..1184,1224..1229,1236..1241,
1245..1250,1257..1262)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1011..1013
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P13797.4); phosphorylation site"
misc_feature 1110..1112
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P13797.4); phosphorylation site"
misc_feature 1305..1307
/gene="PLS3"
/gene_synonym="T-plastin"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (P13797.4); phosphorylation site"
misc_feature 1341..1649
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1341..1343,1350..1352,1359..1361,1533..1538,
1545..1547,1557..1559,1563..1565,1608..1613,1620..1625,
1629..1634,1641..1646)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
misc_feature 1695..2012
/gene="PLS3"
/gene_synonym="T-plastin"
/note="Calponin homology domain; actin-binding domain
which may be present as a single copy or in tandem repeats
(which increases binding affinity). The CH domain is found
in cytoskeletal and signal transduction proteins,
including actin-binding proteins like...; Region: CH;
cd00014"
/db_xref="CDD:28898"
misc_feature order(1698..1706,1713..1715,1722..1724,1902..1907,
1914..1916,1923..1925,1929..1931,1971..1976,1983..1988,
1992..1997,2004..2009)
/gene="PLS3"
/gene_synonym="T-plastin"
/note="putative actin binding surface [polypeptide
binding]; other site"
/db_xref="CDD:28898"
exon 208..371
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 209
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:150018375"
variation 220
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:145235506"
variation 328
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="c"
/db_xref="dbSNP:373153000"
variation 343
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:377475836"
variation 359
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:113492800"
variation 360
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:186923237"
exon 372..501
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 455
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="t"
/db_xref="dbSNP:140121121"
variation 458
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:144784703"
variation 497
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:147957783"
exon 502..634
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 570
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:141907957"
variation 602
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:143815252"
variation 605
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:151153004"
exon 635..716
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
exon 717..882
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 774
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:367830488"
variation 785
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:112589137"
variation 822
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:371332791"
variation 856
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:375187925"
exon 883..1025
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 884
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:376568367"
variation 1010
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:373249162"
variation 1011
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:369914417"
exon 1026..1121
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1026
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:202076515"
variation 1059
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:140968059"
variation 1092
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:137917062"
variation 1108
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:142569974"
exon 1122..1317
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1184
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:113204501"
variation 1235
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:1859671"
exon 1318..1396
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1326
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:377411857"
variation 1328
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:138662773"
variation 1344
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:201842598"
variation 1376
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:2108099"
variation 1379
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:144592792"
variation 1396
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:370999829"
exon 1397..1511
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1409
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:148514983"
variation 1428
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:871774"
exon 1512..1645
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1514
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:75219193"
variation 1553
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140768895"
variation 1610
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:35211005"
exon 1646..1769
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1652
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="g"
/replace="t"
/db_xref="dbSNP:35525703"
variation 1679
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:140069545"
variation 1680
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:199893556"
variation 1730
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:372389185"
variation 1732
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:377191528"
variation 1749
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:150069454"
variation 1762
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:191246889"
exon 1770..1894
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 1795
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="c"
/db_xref="dbSNP:181782110"
variation 1866
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:149142111"
variation 1874
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:145393426"
exon 1895..3327
/gene="PLS3"
/gene_synonym="T-plastin"
/inference="alignment:Splign:1.39.8"
variation 2026
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:369448909"
variation 2067
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373177061"
variation 2078
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:376407795"
variation 2243
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="g"
/db_xref="dbSNP:184318952"
variation 2411
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:144589761"
variation 2671
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:11551495"
variation 2743
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="c"
/replace="t"
/db_xref="dbSNP:370865892"
variation 2919
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:373978498"
polyA_signal 3117..3122
/gene="PLS3"
/gene_synonym="T-plastin"
polyA_site 3138
/gene="PLS3"
/gene_synonym="T-plastin"
variation 3169
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:376902216"
variation 3249
/gene="PLS3"
/gene_synonym="T-plastin"
/replace="a"
/replace="g"
/db_xref="dbSNP:148073444"
ORIGIN
gacttgctctctaaagttgcaattgtaagaagaatgttgggtttccagattgctcttctgggcgtgggagaaggttctgtctatcagtgctgcgagaaaggaaagaaacaagtttgctctcagcggatctttaaatggatgagatggctaccactcagatttccaaagatgagcttgatgaactcaaagaggcctttgcaaaagttgatctcaacagcaacggattcatttgtgactatgaacttcatgagctcttcaaggaagctaatatgccattaccaggatataaagtgagagaaattattcagaaactcatgctggatggtgacaggaataaagatgggaaaataagttttgacgaatttgtttatatttttcaagaggtaaaaagtagtgatattgccaagaccttccgcaaagcaatcaacaggaaagaaggtatttgtgctctgggtggaacttcagagttgtccagcgaaggaacacagcattcttactcagaggaagaaaaatatgcttttgttaactggataaacaaagctttggaaaatgatcctgattgtagacatgttataccaatgaaccctaacaccgatgacctgttcaaagctgttggtgatggaattgtgctttgtaaaatgattaacctttcagttcctgataccattgatgaaagagcaatcaacaagaagaaacttacacccttcatcattcaggaaaacttgaacttggcactgaactctgcttctgccattgggtgtcatgttgtgaacattggtgcagaagatttgagggctgggaaacctcatctggttttgggactgctttggcagatcattaagatcggtttgttcgctgacattgaattaagcaggaatgaagccttggctgctttactccgagatggtgagactttggaggaacttatgaaattgtctccagaagagcttctgcttagatgggcaaactttcatttggaaaactcgggctggcaaaaaattaacaactttagtgctgacatcaaggattccaaagcctatttccatcttctcaatcaaatcgcaccaaaaggacaaaaggaaggtgaaccacggatagatattaacatgtcaggtttcaatgaaacagatgatttgaagagagctgagagtatgcttcaacaagcagataaattaggttgcagacagtttgttacccctgctgatgttgtcagtggaaaccccaaactcaacttagctttcgtggctaacctgtttaataaatacccagcactaactaagccagagaaccaggatattgactggactctattagaaggagaaactcgtgaagaaagaaccttccgtaactggatgaactctcttggtgtcaatcctcacgtaaaccatctctatgctgacctgcaagatgccctggtaatcttacagttatatgaacgaattaaagttcctgttgactggagtaaggttaataaacctccatacccgaaactgggagccaacatgaaaaagctagaaaactgcaactatgctgttgaattagggaagcatcctgctaaattctccctggttggcattggagggcaagacctgaatgatgggaaccaaaccctgactttagctttagtctggcagctgatgagaagatataccctcaatgtcctggaagatcttggagatggtcagaaagccaatgacgacatcattgtgaactgggtgaacagaacgttgagtgaagctggaaaatcaacttccattcagagttttaaggacaagacgatcagctccagtttggcagttgtggatttaattgatgccatccagccaggctgtataaactatgaccttgtgaagagtggcaatctaacagaagatgacaagcacaataatgccaagtatgcagtgtcaatggctagaagaatcggagccagagtgtatgctctccctgaagaccttgtggaagtaaagcccaagatggtcatgactgtgtttgcatgtttgatgggcaggggaatgaagagagtgtaaaataaccaatctgaataaaacagccatgctcccaggtgcatgattcgcaggtcagctatttccaggtgaagtgcttatggcttaaggaactcttggccattcaaaggacttttcattttgattaacaggactagcttatcatgagagccctcaggggaaagggtttaagaaaaacaactcctctttcccatagtcagagttgaatttgtcaggcacgcctgaaatgtgctcatagccaaaacattttactctctcctcctagaatgctgcccttgacatttcccattgctgtatgttatttcttgctctgttatcttttgccctcttagaatgtccctctcttgggacttgcttagatgatgggatatgaatattattagacagtaattttgctttccatccagtatgctagttcttattcgagaactatggtcagagcgtatttggatatgagtatcctttgcttatctttgtagtactgaaaatttgccgaagtaactggctgtgcagaatgtaatagaagcttttcttattcttttattcttaagatcagtatctttttacagtattctttctacatgatccttttttgtacatttaagaatattttgattatattaaacaagactgctgattttgctactttttttaaggggtcttcaagtaagtaaaacatacatcgtagctagaagaaaaatgtaccttaaatttgcatcttccctctcatacccaagctgtaaacaattgaaatattttgtcttaaatcacttggttcaatacatgcttatttgttttaaaacctgtatcatcaaactctctctctaaatttaaaatgctgttgaatatgatacttttgaggagagagtgtgctcagaacttagacgggatttggtaggccaagtatgctaagtgtacaatatattttttaattttacacctgaaacaaagaaatgtggtcactaaaaataaaagtatatatgtaggaattaatgtactcttgctttgtcaagctgtttgctatagtttccaaggtattatgttactctaactctgaaaagtgatgtaatctggtagcaatgtagtagttcaaataaaggcatttacataataattagtctgttcttcatgcttttgtctcttaggaagtatgccaatgtttgtcaggatttttttctttttgtttttctgatgtattctgtaaaatggtgtttgttaaatttgagttttgggagctgaattagaggtactgaattaaggacagtacaaatgaagtaaaaaggttttctccaatttaccaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5358 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:5358 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
GeneID:5358 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.