GGRNA Home | Help | Advanced search

2024-04-25 09:17:38, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001080837             665 bp    mRNA    linear   PRI 07-JAN-2013
DEFINITION  Homo sapiens SEBOX homeobox (SEBOX), mRNA.
ACCESSION   NM_001080837 XM_940459 XR_017040
VERSION     NM_001080837.2  GI:194688141
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 665)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   2  (bases 1 to 665)
  AUTHORS   Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C.,
            Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R.,
            Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A.,
            Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C.,
            Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S.,
            Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N.,
            Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am. J. Hum. Genet. 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 665)
  AUTHORS   Cinquanta,M., Rovescalli,A.C., Kozak,C.A. and Nirenberg,M.
  TITLE     Mouse Sebox homeobox gene expression in skin, brain, oocytes, and
            two-cell embryos
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (16), 8904-8909 (2000)
   PUBMED   10922053
  REMARK    GeneRIF: This publication reported the human SEBOX gene sequence
            and predicted amino acid sequence, in addition to mouse and rat
            Sebox gene sequences.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC002094.1.
            On Jul 30, 2008 this sequence version replaced gi:124249389.
            
            Summary: Homeodomain proteins, such as SEBOX, play a key role in
            coordinating gene expression during development (Cinquanta et al.,
            2000 [PubMed 10922053]).[supplied by OMIM, Mar 2008].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-123               AC002094.1         35828-35950
            124-284             AC002094.1         36116-36276
            285-665             AC002094.1         36423-36803
FEATURES             Location/Qualifiers
     source          1..665
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q11.2"
     gene            1..665
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /note="SEBOX homeobox"
                     /db_xref="GeneID:645832"
                     /db_xref="HGNC:32942"
                     /db_xref="MIM:610975"
     exon            1..123
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /inference="alignment:Splign:1.39.8"
     CDS             15..665
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /note="homeobox OG-9; skin-, embryo-, brain- and
                     oocyte-specific homeobox"
                     /codon_start=1
                     /product="homeobox protein SEBOX"
                     /protein_id="NP_001074306.2"
                     /db_xref="GI:194688142"
                     /db_xref="CCDS:CCDS45634.1"
                     /db_xref="GeneID:645832"
                     /db_xref="HGNC:32942"
                     /db_xref="MIM:610975"
                     /translation="
MGGSGVGTAWHGPLARPSGTLPFASSMPSPVDASSADGGSGLGSHRRKRTTFSKGQLLELERAFAAWPYPNISTHEHLAWVTCLPEAKVQVWFQKRWAKIIKNRKSGILSPGSECPQSSCSLPDTLQQPWDPQMPGQPPPSSGTPQRTSVCRHSSCPAPGLSPRQGWEGAKAVAPWGSAGASEVHPSLERATPQTSLGSLSDLIYALAIVVNVDHS
"
     misc_feature    150..326
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(150..164,168..170,219..221,237..239,276..278,
                     282..287,294..299,303..311,315..320)
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(156..158,165..167,285..287,294..299,306..308)
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       60
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111302947"
     exon            124..284
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /inference="alignment:Splign:1.39.8"
     variation       185
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2277667"
     exon            285..665
                     /gene="SEBOX"
                     /gene_synonym="OG-9; OG9; OG9X"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      
atgataaaacccaaatgggggggtctggtgtgggcacagcctggcatggccctctggcacggccctctggcaccttaccctttgccagctccatgcccagccctgtggatgcatcctcagcagacggtggcagcgggttgggttcccaccggagaaagcggaccaccttcagcaaagggcagctactggagctggagagggcgtttgcagcatggccctaccccaacatcagcacccatgagcacctggcctgggtcacttgccttcctgaggccaaggtacaggtgtggttccagaagcgctgggccaaaataatcaagaacaggaagtcaggaattctaagccctgggtctgagtgcccccagagctcctgttctcttccagacaccctccagcagccctgggatccccaaatgccaggccaacctccaccctccagcggcacacctcagcgcacctcagtgtgtcgacatagctcctgtccagctcctggcttgagtccacggcagggctgggaaggggctaaagctgtagccccatggggatcagctggggcttcagaggtccacccttctttagagcgagctactccccagacttcactaggcagcctgtctgacctcatctatgccttggccattgtcgtcaatgtggaccactcctag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:645832 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
            GeneID:645832 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:645832 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:645832 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:645832 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:645832 -> Biological process: GO:0008150 [biological_process] evidence: ND
            GeneID:645832 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
            GeneID:645832 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
            GeneID:645832 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.