2024-04-20 09:55:07, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001080837 665 bp mRNA linear PRI 07-JAN-2013 DEFINITION Homo sapiens SEBOX homeobox (SEBOX), mRNA. ACCESSION NM_001080837 XM_940459 XR_017040 VERSION NM_001080837.2 GI:194688141 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 665) AUTHORS Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V., Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 2 (bases 1 to 665) AUTHORS Talmud,P.J., Drenos,F., Shah,S., Shah,T., Palmen,J., Verzilli,C., Gaunt,T.R., Pallas,J., Lovering,R., Li,K., Casas,J.P., Sofat,R., Kumari,M., Rodriguez,S., Johnson,T., Newhouse,S.J., Dominiczak,A., Samani,N.J., Caulfield,M., Sever,P., Stanton,A., Shields,D.C., Padmanabhan,S., Melander,O., Hastie,C., Delles,C., Ebrahim,S., Marmot,M.G., Smith,G.D., Lawlor,D.A., Munroe,P.B., Day,I.N., Kivimaki,M., Whittaker,J., Humphries,S.E. and Hingorani,A.D. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am. J. Hum. Genet. 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 3 (bases 1 to 665) AUTHORS Cinquanta,M., Rovescalli,A.C., Kozak,C.A. and Nirenberg,M. TITLE Mouse Sebox homeobox gene expression in skin, brain, oocytes, and two-cell embryos JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (16), 8904-8909 (2000) PUBMED 10922053 REMARK GeneRIF: This publication reported the human SEBOX gene sequence and predicted amino acid sequence, in addition to mouse and rat Sebox gene sequences. COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC002094.1. On Jul 30, 2008 this sequence version replaced gi:124249389. Summary: Homeodomain proteins, such as SEBOX, play a key role in coordinating gene expression during development (Cinquanta et al., 2000 [PubMed 10922053]).[supplied by OMIM, Mar 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-123 AC002094.1 35828-35950 124-284 AC002094.1 36116-36276 285-665 AC002094.1 36423-36803 FEATURES Location/Qualifiers source 1..665 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="17" /map="17q11.2" gene 1..665 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /note="SEBOX homeobox" /db_xref="GeneID:645832" /db_xref="HGNC:32942" /db_xref="MIM:610975" exon 1..123 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /inference="alignment:Splign:1.39.8" CDS 15..665 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /note="homeobox OG-9; skin-, embryo-, brain- and oocyte-specific homeobox" /codon_start=1 /product="homeobox protein SEBOX" /protein_id="NP_001074306.2" /db_xref="GI:194688142" /db_xref="CCDS:CCDS45634.1" /db_xref="GeneID:645832" /db_xref="HGNC:32942" /db_xref="MIM:610975" /translation="
MGGSGVGTAWHGPLARPSGTLPFASSMPSPVDASSADGGSGLGSHRRKRTTFSKGQLLELERAFAAWPYPNISTHEHLAWVTCLPEAKVQVWFQKRWAKIIKNRKSGILSPGSECPQSSCSLPDTLQQPWDPQMPGQPPPSSGTPQRTSVCRHSSCPAPGLSPRQGWEGAKAVAPWGSAGASEVHPSLERATPQTSLGSLSDLIYALAIVVNVDHS
" misc_feature 150..326 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(150..164,168..170,219..221,237..239,276..278, 282..287,294..299,303..311,315..320) /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(156..158,165..167,285..287,294..299,306..308) /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" variation 60 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /replace="c" /replace="t" /db_xref="dbSNP:111302947" exon 124..284 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /inference="alignment:Splign:1.39.8" variation 185 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /replace="a" /replace="g" /db_xref="dbSNP:2277667" exon 285..665 /gene="SEBOX" /gene_synonym="OG-9; OG9; OG9X" /inference="alignment:Splign:1.39.8" ORIGIN
atgataaaacccaaatgggggggtctggtgtgggcacagcctggcatggccctctggcacggccctctggcaccttaccctttgccagctccatgcccagccctgtggatgcatcctcagcagacggtggcagcgggttgggttcccaccggagaaagcggaccaccttcagcaaagggcagctactggagctggagagggcgtttgcagcatggccctaccccaacatcagcacccatgagcacctggcctgggtcacttgccttcctgaggccaaggtacaggtgtggttccagaagcgctgggccaaaataatcaagaacaggaagtcaggaattctaagccctgggtctgagtgcccccagagctcctgttctcttccagacaccctccagcagccctgggatccccaaatgccaggccaacctccaccctccagcggcacacctcagcgcacctcagtgtgtcgacatagctcctgtccagctcctggcttgagtccacggcagggctgggaaggggctaaagctgtagccccatggggatcagctggggcttcagaggtccacccttctttagagcgagctactccccagacttcactaggcagcctgtctgacctcatctatgccttggccattgtcgtcaatgtggaccactcctag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:645832 -> Molecular function: GO:0003674 [molecular_function] evidence: ND GeneID:645832 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:645832 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:645832 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:645832 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA GeneID:645832 -> Biological process: GO:0008150 [biological_process] evidence: ND GeneID:645832 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA GeneID:645832 -> Cellular component: GO:0005575 [cellular_component] evidence: ND GeneID:645832 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.