2024-04-27 05:54:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001080458 1617 bp mRNA linear PRI 15-JUN-2013 DEFINITION Homo sapiens even-skipped homeobox 2 (EVX2), mRNA. ACCESSION NM_001080458 XM_292968 VERSION NM_001080458.1 GI:122937318 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1617) AUTHORS Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M., Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S. TITLE Genome-wide association study of periodontal pathogen colonization JOURNAL J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012) PUBMED 22699663 REFERENCE 2 (bases 1 to 1617) AUTHORS Goodman,F.R., Majewski,F., Collins,A.L. and Scambler,P.J. TITLE A 117-kb microdeletion removing HOXD9-HOXD13 and EVX2 causes synpolydactyly JOURNAL Am. J. Hum. Genet. 70 (2), 547-555 (2002) PUBMED 11778160 REMARK GeneRIF: 117-kb microdeletion removing HOXD9-HOXD13 and EVX2 causes synpolydactyly REFERENCE 3 (bases 1 to 1617) AUTHORS Limongi,M.Z., Pelliccia,F., Gaddini,L. and Rocchi,A. TITLE Clustering of two fragile sites and seven homeobox genes in human chromosome region 2q31-->q32.1 JOURNAL Cytogenet. Cell Genet. 90 (1-2), 151-153 (2000) PUBMED 11060466 REFERENCE 4 (bases 1 to 1617) AUTHORS Slavotinek,A., Schwarz,C., Getty,J.F., Stecko,O., Goodman,F. and Kingston,H. TITLE Two cases with interstitial deletions of chromosome 2 and sex reversal in one JOURNAL Am. J. Med. Genet. 86 (1), 75-81 (1999) PUBMED 10440834 REFERENCE 5 (bases 1 to 1617) AUTHORS Sarfarazi,M., Akarsu,A.N. and Sayli,B.S. TITLE Localization of the syndactyly type II (synpolydactyly) locus to 2q31 region and identification of tight linkage to HOXD8 intragenic marker JOURNAL Hum. Mol. Genet. 4 (8), 1453-1458 (1995) PUBMED 7581388 REFERENCE 6 (bases 1 to 1617) AUTHORS Rossi,E., Faiella,A., Zeviani,M., Labeit,S., Floridia,G., Brunelli,S., Cammarata,M., Boncinelli,E. and Zuffardi,O. TITLE Order of six loci at 2q24-q31 and orientation of the HOXD locus JOURNAL Genomics 24 (1), 34-40 (1994) PUBMED 7896287 REFERENCE 7 (bases 1 to 1617) AUTHORS D'Esposito,M., Morelli,F., Acampora,D., Migliaccio,E., Simeone,A. and Boncinelli,E. TITLE EVX2, a human homeobox gene homologous to the even-skipped segmentation gene, is localized at the 5' end of HOX4 locus on chromosome 2 JOURNAL Genomics 10 (1), 43-50 (1991) PUBMED 1675198 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC009336.13. This sequence is a reference standard in the RefSeqGene project. On Jan 18, 2007 this sequence version replaced gi:113413336. Summary: This gene is located at the 5' end of the HOXD gene cluster on chromosome 2. The encoded protein is a homeobox transcription factor that is related to the protein encoded by the Drosophila even-skipped (eve) gene, a member of the pair-rule class of segmentation genes. A 117 kb microdeletion at the 5' end of the HOXD gene cluster, which includes this gene and the HOXD9-HOXD13 genes, causes synpolydactyly, a dominantly inherited disease resulting in limb malformation. [provided by RefSeq, Sep 2009]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence because no single transcript was available for the full length of the gene. The genomic coordinates used for the transcript record were based on alignments of partial ESTs, homologous transcripts, and data in PMID:1675198. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025090 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-613 AC009336.13 67339-67951 c 614-885 AC009336.13 66167-66438 c 886-1617 AC009336.13 64096-64827 c FEATURES Location/Qualifiers source 1..1617 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="2" /map="2q31.1" gene 1..1617 /gene="EVX2" /gene_synonym="EVX-2" /note="even-skipped homeobox 2" /db_xref="GeneID:344191" /db_xref="HGNC:3507" /db_xref="MIM:142991" exon 1..613 /gene="EVX2" /gene_synonym="EVX-2" /inference="alignment:Splign:1.39.8" misc_feature 124..126 /gene="EVX2" /gene_synonym="EVX-2" /note="upstream in-frame stop codon" CDS 187..1617 /gene="EVX2" /gene_synonym="EVX-2" /note="eve, even-skipped homeo box homolog 2; even-skipped homeo box 2 (homolog of Drosophila eve)" /codon_start=1 /product="homeobox even-skipped homolog protein 2" /protein_id="NP_001073927.1" /db_xref="GI:122937319" /db_xref="CCDS:CCDS33333.1" /db_xref="GeneID:344191" /db_xref="HGNC:3507" /db_xref="MIM:142991" /translation="
MMERIRKEMILMERGLHSPTAGKRFSNLSNSAGNAVLEALENSQHPARLSPRLPSAPLHSALGELPAKGKFEIDTLFNLQHTGSESTVSSEISSAAESRKKPGHYSEAAAEADMSSDVEVGCSALRSPGGLGAAQLKENNGKGYAESGSAAGTTTSASGSGLGSLHGGSGGSGGSAALGGSGSGADQVRRYRTAFTREQIARLEKEFYRENYVSRPRRCELAAALNLPETTIKVWFQNRRMKDKRQRLAMSWPHPADPSFYTYMMTHAAATGSLPYPFHSHVPLHYYPHVGVTAAAAAAAASGAAAAASSPFATSIRPLDTFRALSHPYSRPELLCSFRHPGLYQAPAAAAGLNSAASAAAAAAAAAAAASSAAAAGAPPSGGSAPCSCLSCHSSQSAAAAAAAAAAALGSRGGGGGGGGGGGGGGGGAGAGGGSDFGCSAAAPRSESGFLPYSAAVLSKTAVSPPDQRDEAPLTR
" misc_feature 751..927 /gene="EVX2" /gene_synonym="EVX-2" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(751..765,769..771,820..822,838..840,877..879, 883..888,895..900,904..912,916..921) /gene="EVX2" /gene_synonym="EVX-2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(757..759,766..768,886..888,895..900,907..909) /gene="EVX2" /gene_synonym="EVX-2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" exon 614..885 /gene="EVX2" /gene_synonym="EVX-2" /inference="alignment:Splign:1.39.8" exon 886..1617 /gene="EVX2" /gene_synonym="EVX-2" /inference="alignment:Splign:1.39.8" variation 1440 /gene="EVX2" /gene_synonym="EVX-2" /replace="c" /replace="t" /db_xref="dbSNP:1868101" ORIGIN
aggatgtatgggtcattttgaccagtcattccctcgctctggcatcccacaatttttccgcctccctccgaaagcgataataatatttagaggcgttcgctggggctgaatgagaattagccctaggcgcagcctatcattaggacgggacagcagggccactgtgacatttttaagaaagctgagatgatggaaagaataagaaaagagatgattctgatggagagagggctgcacagccctacggcgggcaagagattctccaatttgtccaactcggctggcaatgctgtgctcgaggccctggaaaattcgcagcacccggctcgcctaagcccgcgcctgccgtctgcccccctgcacagcgctctgggagaactccccgccaagggcaaattcgaaatagacactttgttcaacctgcagcacacgggcagcgaaagcaccgtctcctccgaaatctcctccgccgccgagagccgcaagaagccgggccattattcagaggcggccgctgaggccgacatgagcagcgacgtggaggtgggctgctccgcgcttcgctcccccgggggcctcggcgccgctcagcttaaggaaaacaatggcaaagggtacgcagagagcggctcggctgccggcaccacgacgtcggcgtcgggctcaggcctcggaagcctgcatggaggcagcggaggcagcggcgggagcgcggcgctgggtggctccggctctggcgcggatcaagtgcggcgctaccgtacggcgttcacccgcgagcagatcgcgcgcctggagaaggagttctaccgggagaactatgtgtcgcggccccgccggtgcgagctggccgcggcactcaacctgcccgaaaccaccatcaaggtgtggttccagaaccggcgcatgaaggacaagcggcagcgcctggccatgtcctggccgcacccagccgaccccagcttctacacctacatgatgacgcacgcggccgccaccggaagcctgccctaccccttccactcgcacgtgccgctgcactactacccgcacgtgggcgtcacggcggcggcggccgcggctgcagcctcaggcgcggcggccgcggcttcgtcgcccttcgctacttccatccggccactggacaccttccgcgccctctcgcacccctactctcggccggagctgctgtgtagcttccgccaccctggtctctaccaggctcccgcggccgccgcggggctcaacagcgcggcctctgccgcggcagccgcggcagccgcagcggctgcggcctcctcggcggcggcggccggcgcgccccccagcggcggctctgcaccctgctcgtgcctcagttgccacagcagtcagtcggcggcggcagccgcggcagcagctgccgcagccctgggttcccggggtggcggtggcggcggcggtggtggtggtggcggcggcggcgggggcgccggggccgggggaggctcggacttcggctgcagcgcggcggcgccgcgttccgagagcggcttcctgccctactcggccgcggtgcttagtaagacggccgtgagcccgccggaccagagggacgaggctccgctcaccagataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:344191 -> Molecular function: GO:0003677 [DNA binding] evidence: NAS GeneID:344191 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:344191 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:344191 -> Biological process: GO:0008150 [biological_process] evidence: ND GeneID:344191 -> Biological process: GO:0035108 [limb morphogenesis] evidence: IEA GeneID:344191 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:344191 -> Cellular component: GO:0005634 [nucleus] evidence: NAS GeneID:344191 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.