2024-04-19 12:52:55, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001080413 2076 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens NOBOX oogenesis homeobox (NOBOX), mRNA. ACCESSION NM_001080413 XM_001134420 VERSION NM_001080413.3 GI:333470750 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2076) AUTHORS Bouilly,J., Bachelot,A., Broutin,I., Touraine,P. and Binart,N. TITLE Novel NOBOX loss-of-function mutations account for 6.2% of cases in a large primary ovarian insufficiency cohort JOURNAL Hum. Mutat. 32 (10), 1108-1113 (2011) PUBMED 21837770 REMARK GeneRIF: The very high 6.2% prevalence of these new mutations in POI patients suggest considering NOBOX as the first autosomal candidate gene involved in this syndrome. REFERENCE 2 (bases 1 to 2076) AUTHORS Brauner,R., Bashamboo,A., Rouget,S., Goulet,M., Philibert,P., Sarda-Thibault,H., Trivin,C., Misrahi,M., Sultan,C. and McElreavey,K. TITLE Clinical, biological and genetic analysis of prepubertal isolated ovarian cyst in 11 girls JOURNAL PLoS ONE 5 (6), E11282 (2010) PUBMED 20593028 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 2076) AUTHORS van Dooren,M.F., Bertoli-Avellab,A.M. and Oldenburg,R.A. TITLE Premature ovarian failure and gene polymorphisms JOURNAL Curr. Opin. Obstet. Gynecol. 21 (4), 313-317 (2009) PUBMED 19610175 REMARK Review article REFERENCE 4 (bases 1 to 2076) AUTHORS Qin,Y., Shi,Y., Zhao,Y., Carson,S.A., Simpson,J.L. and Chen,Z.J. TITLE Mutation analysis of NOBOX homeodomain in Chinese women with premature ovarian failure JOURNAL Fertil. Steril. 91 (4 SUPPL), 1507-1509 (2009) PUBMED 18930203 REMARK GeneRIF: Mutations in the homeobox domain of NOBOX are not common explanations for POF in Chinese women. GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 2076) AUTHORS Oldenburg,R.A., van Dooren,M.F., de Graaf,B., Simons,E., Govaerts,L., Swagemakers,S., Verkerk,J.M., Oostra,B.A. and Bertoli-Avella,A.M. TITLE A genome-wide linkage scan in a Dutch family identifies a premature ovarian failure susceptibility locus JOURNAL Hum. Reprod. 23 (12), 2835-2841 (2008) PUBMED 18689850 REFERENCE 6 (bases 1 to 2076) AUTHORS Huntriss,J., Hinkins,M. and Picton,H.M. TITLE cDNA cloning and expression of the human NOBOX gene in oocytes and ovarian follicles JOURNAL Mol. Hum. Reprod. 12 (5), 283-289 (2006) PUBMED 16597639 REMARK GeneRIF: NOBOX expression within adult human tissues is limited to the testis, pancreas and oocyte specific in ovary. REFERENCE 7 (bases 1 to 2076) AUTHORS Zhao,X.X., Suzumori,N., Yamaguchi,M. and Suzumori,K. TITLE Mutational analysis of the homeobox region of the human NOBOX gene in Japanese women who exhibit premature ovarian failure JOURNAL Fertil. Steril. 83 (6), 1843-1844 (2005) PUBMED 15950662 REMARK GeneRIF: Mutations of the homeobox region of the NOBOX gene are uncommon in Japanese patients with premature ovarian failure. REFERENCE 8 (bases 1 to 2076) AUTHORS Rajkovic,A., Pangas,S.A., Ballow,D., Suzumori,N. and Matzuk,M.M. TITLE NOBOX deficiency disrupts early folliculogenesis and oocyte-specific gene expression JOURNAL Science 305 (5687), 1157-1159 (2004) PUBMED 15326356 REFERENCE 9 (bases 1 to 2076) AUTHORS Suzumori,N., Yan,C., Matzuk,M.M. and Rajkovic,A. TITLE Nobox is a homeobox-encoding gene preferentially expressed in primordial and growing oocytes JOURNAL Mech. Dev. 111 (1-2), 137-141 (2002) PUBMED 11804785 REFERENCE 10 (bases 1 to 2076) AUTHORS Rovescalli,A.C., Asoh,S. and Nirenberg,M. TITLE Cloning and characterization of four murine homeobox genes JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (20), 10691-10696 (1996) PUBMED 8855241 REMARK Erratum:[Proc Natl Acad Sci U S A 1996 Dec 24;93(26):15522] COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC004534.1. This sequence is a reference standard in the RefSeqGene project. On May 20, 2011 this sequence version replaced gi:269784634. Summary: This homeobox gene encodes a transcription factor that is thought to play a role in oogenesis. In mice, it is essential for folliculogenesis and regulation of oocyte-specific genes. Defects in this gene result in premature ovarian failure type 5.[provided by RefSeq, May 2011]. Sequence Note: The RefSeq transcript and protein were assembled by in silico methods based on partial sequence data reported in PMID: 16597639 and additional support from similarity to mouse protein NP_570939.1. The 5' and 3' exons have not been experimentally verified in humans. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025085 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-85 AC004534.1 65518-65602 c 86-210 AC004534.1 59931-60055 c 211-292 AC004534.1 57244-57325 c 293-844 AC004534.1 56421-56972 c 845-1047 AC004534.1 55485-55687 c 1048-1154 AC004534.1 55132-55238 c 1155-1240 AC004534.1 54772-54857 c 1241-1469 AC004534.1 54325-54553 c 1470-1774 AC004534.1 53657-53961 c 1775-2076 AC004534.1 52615-52916 c FEATURES Location/Qualifiers source 1..2076 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q35" gene 1..2076 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /note="NOBOX oogenesis homeobox" /db_xref="GeneID:135935" /db_xref="HGNC:22448" /db_xref="MIM:610934" CDS 1..2076 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /note="newborn ovary homeobox-encoding" /codon_start=1 /product="homeobox protein NOBOX" /protein_id="NP_001073882.3" /db_xref="GI:333470751" /db_xref="GeneID:135935" /db_xref="HGNC:22448" /db_xref="MIM:610934" /translation="
MALLLTLTSPDLEGTWDTRDKDGFKAQEGPPLAVPEFPVCGLYRIYGVCGSFSSFFIIRCSLCALETLKSPQHDPLEIPEQSLKLIPLVSGKRELTRGQKAGEKPLAAGPGEEELLRGSAPHAQDTQSEELPPSCTISGEKKPPAVSGEATGADAGRLCPPPRSRAPHKDRTLARSRPQTQGEDCSLPVGEVKIGKRSYSPAPGKQKKPNAMGLAPTSSPGAPNSARATHNPVPCGSGRGPCHLANLLSTLAQSNQNRDHKQGPPEVTCQIRKKTRTLYRSDQLEELEKIFQEDHYPDSDKRREIAQTVGVTPQRIMVKGAGSLVAGWSGGGPTIETLELQSERSAVAWVWFQNRRAKWRKMEKLNGKESKDNPAAPGPASSQCSSAAEILPAVPMEPKPDPFPQESPLDTFPEPPMLLTSDQTLAPTQPSEGAQRVVTPPLFSPPPVRRADLPFPLGPVHTPQLMPLLMDVAGSDSSHKDGPCGSWGTSITLPPPCSYLEELEPQDYQQSNQPGPFQFSQAPQPPLFQSPQPKLPYLPTFPFSMPSSLTLPPPEDSLFMFPCGPSGGTSQGYCPGASSGQILMQPPAGNIGTASWSDPCLPELPFPGPFCPQALGHPPGGDGYFPDLFPTPCPQALGRQPSSALSWMPEGARPGTGPLLSKAKEEPPAASLDQPSALEEARGDDKNSHVP
" misc_feature 817..1089 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(817..831,835..837,886..888,904..906,943..945, 949..951,1048..1050,1057..1062,1066..1074,1078..1083) /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(823..825,832..834,1048..1050,1057..1062,1069..1071) /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature <1120..1590 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /note="Herpesvirus transcription activation factor (transactivator); Region: Herpes_TAF50; pfam03326" /db_xref="CDD:112154" exon 1..85 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 86..210 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" variation 126 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /replace="c" /replace="g" /db_xref="dbSNP:2003479" exon 211..292 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 293..844 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 845..1047 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 1048..1154 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 1155..1240 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 1241..1469 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" exon 1470..1774 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" variation 1549 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /replace="c" /replace="t" /db_xref="dbSNP:2699503" exon 1775..2076 /gene="NOBOX" /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042" /inference="alignment:Splign:1.39.8" ORIGIN
atggctctccttttgacactaacatcaccagacctggagggtacctgggacaccagagacaaggatggcttcaaagcccaggaggggccgcccctggctgtacctgaatttcctgtgtgtggactgtaccggatctacggagtctgtggctctttcagctccttcttcatcatccggtgcagcctttgtgctctggagaccctcaaatcaccccaacatgatcccttagagatacctgaacagtccctcaaactcatacccctggtgtctgggaaaagggaactcacaaggggccagaaagctggagagaagcccctggctgcaggacccggggaggaggaactgctccggggctcagcccctcatgctcaggacactcagagtgaggaactgccaccctcctgcaccatctcaggagagaagaagccgccagcagtctctggagaagccaccggggctgatgctgggagactgtgcccgcccccccgctccagggctccccacaaagacagaactctagcccgctccaggccccagactcagggggaagattgttccctcccagtgggagaggtgaagataggaaagaggtcctattctccagcccccgggaagcagaaaaagcctaatgccatgggtctggccccaacatcatctccgggtgcccctaactcagcccgtgccacacacaacccagtgccctgtgggtcaggccgggggccctgccacctggccaatctcctcagtacattggcgcagagcaaccaaaacagagaccacaagcaggggcccccggaagtgacctgccaaattaggaaaaagacacgaaccctataccgctcagatcagctggaggagctagagaagatattccaagaagaccactatcctgacagtgataaacgccgagagattgcccagacggtgggggtgaccccccagcgcatcatggtaaagggggccggctcactggtggcagggtggagtggcggagggcccaccattgaaacactcgaattgcagagtgagcgctcagcggtagcctgggtgtggttccagaatcgccgggccaagtggcgaaaaatggagaaactgaatgggaaagaaagcaaggacaatcctgcagcccctggccctgccagcagtcaatgcagctctgcagctgagatcctacctgctgtgcccatggagccaaagcctgaccctttccctcaggagtcccctctggatacctttccagagccccccatgctgctgacttctgaccagactttggcccccacccaacccagtgagggtgctcagagggtggtgacccccccactcttcagccccccacctgtgcgaagggccgatcttcctttcccccttggccctgtccacaccccccaactgatgccactgctgatggatgttgctggcagtgacagcagccacaaggacggcccctgtgggtcctgggggacaagcatcaccctgccacccccctgttcatatttggaggagctggagccccaggattaccaacagagcaaccagccaggacccttccagttctcccaggctccacagcccccgcttttccagtcccctcagcccaagttgccctacctccccactttccccttctccatgcccagttcactgacgcttccaccgcccgaagactctctctttatgtttccctgtggccccagcgggggcacatcgcagggctattgcccaggtgcctcctcaggacagatcctgatgcaaccacctgctgggaatataggtacagcctcctggagtgacccctgtttgccagagctgcccttccctggtccgttctgcccacaagctctggggcatcccccaggaggggatggctactttcctgatctatttccaactccctgcccccaggctctgggcaggcagccttcgtcagctctctcatggatgcctgaaggggccagaccagggactgggcccttactcagcaaggcaaaagaggaaccaccagctgcttccctggatcagccctcagcactggaggaggccagaggggatgacaagaatagccatgtcccctag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:135935 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:135935 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:135935 -> Biological process: GO:0001541 [ovarian follicle development] evidence: IEA GeneID:135935 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:135935 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA GeneID:135935 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:135935 -> Biological process: GO:0048477 [oogenesis] evidence: IEA GeneID:135935 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.