GGRNA Home | Help | Advanced search

2024-04-27 11:27:12, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001067               5753 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens topoisomerase (DNA) II alpha 170kDa (TOP2A), mRNA.
ACCESSION   NM_001067
VERSION     NM_001067.3  GI:300193028
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5753)
  AUTHORS   Chen,S., Huang,L., Liu,Y., Chen,C.M., Wu,J. and Shao,Z.M.
  TITLE     The predictive and prognostic significance of pre- and
            post-treatment topoisomerase IIalpha in anthracycline-based
            neoadjuvant chemotherapy for local advanced breast cancer
  JOURNAL   Eur J Surg Oncol 39 (6), 619-626 (2013)
   PUBMED   23473851
  REMARK    GeneRIF: Topo IIalpha, together with HER-2, might help to select
            for patients who could benefit from anthracycline-based neoadjuvant
            chemotherapy and identify non-complete responders at a higher risk
            of disease recurrence or death.
REFERENCE   2  (bases 1 to 5753)
  AUTHORS   Dykhuizen,E.C., Hargreaves,D.C., Miller,E.L., Cui,K., Korshunov,A.,
            Kool,M., Pfister,S., Cho,Y.J., Zhao,K. and Crabtree,G.R.
  TITLE     BAF complexes facilitate decatenation of DNA by topoisomerase
            IIalpha
  JOURNAL   Nature 497 (7451), 624-627 (2013)
   PUBMED   23698369
  REMARK    GeneRIF: studies indicate that the ability of TOP2A to prevent DNA
            entanglement at mitosis requires BAF complexes and suggest that
            this activity contributes to the role of BAF subunits as tumour
            suppressors
REFERENCE   3  (bases 1 to 5753)
  AUTHORS   Seol,Y., Gentry,A.C., Osheroff,N. and Neuman,K.C.
  TITLE     Chiral discrimination and writhe-dependent relaxation mechanism of
            human topoisomerase IIalpha
  JOURNAL   J. Biol. Chem. 288 (19), 13695-13703 (2013)
   PUBMED   23508957
  REMARK    GeneRIF: Mechanistic basis for chiral discrimination and
            explanation for the effects of DNA twist and tension on eukaryotic
            type IIA topoisomerases.
REFERENCE   4  (bases 1 to 5753)
  AUTHORS   Sundov,D., Caric,A., Mrklic,I., Gugic,D., Capkun,V., Hofman,I.D.,
            Mise,B.P. and Tomic,S.
  TITLE     P53, MAPK, topoisomerase II alpha and Ki67 immunohistochemical
            expression and KRAS/BRAF mutation in ovarian serous carcinomas
  JOURNAL   Diagn Pathol 8, 21 (2013)
   PUBMED   23388101
  REMARK    GeneRIF: Report topoisomerase II alpha expression in ovarian serous
            carcinoma.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 5753)
  AUTHORS   Keith,W.N., Tan,K.B. and Brown,R.
  TITLE     Amplification of the topoisomerase II alpha gene in a non-small
            cell lung cancer cell line and characterisation of polymorphisms at
            the human topoisomerase II alpha and beta loci in normal tissue
  JOURNAL   Genes Chromosomes Cancer 4 (2), 169-175 (1992)
   PUBMED   1373318
REFERENCE   6  (bases 1 to 5753)
  AUTHORS   Tan,K.B., Dorman,T.E., Falls,K.M., Chung,T.D., Mirabelli,C.K.,
            Crooke,S.T. and Mao,J.
  TITLE     Topoisomerase II alpha and topoisomerase II beta genes:
            characterization and mapping to human chromosomes 17 and 3,
            respectively
  JOURNAL   Cancer Res. 52 (1), 231-234 (1992)
   PUBMED   1309226
REFERENCE   7  (bases 1 to 5753)
  AUTHORS   Bugg,B.Y., Danks,M.K., Beck,W.T. and Suttle,D.P.
  TITLE     Expression of a mutant DNA topoisomerase II in CCRF-CEM human
            leukemic cells selected for resistance to teniposide
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 88 (17), 7654-7658 (1991)
   PUBMED   1652758
REFERENCE   8  (bases 1 to 5753)
  AUTHORS   Chung,T.D., Drake,F.H., Tan,K.B., Per,S.R., Crooke,S.T. and
            Mirabelli,C.K.
  TITLE     Characterization and immunological identification of cDNA clones
            encoding two human DNA topoisomerase II isozymes
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 86 (23), 9431-9435 (1989)
   PUBMED   2556712
REFERENCE   9  (bases 1 to 5753)
  AUTHORS   Tsai-Pflugfelder,M., Liu,L.F., Liu,A.A., Tewey,K.M., Whang-Peng,J.,
            Knutsen,T., Huebner,K., Croce,C.M. and Wang,J.C.
  TITLE     Cloning and sequencing of cDNA encoding human DNA topoisomerase II
            and localization of the gene to chromosome region 17q21-22
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 85 (19), 7177-7181 (1988)
   PUBMED   2845399
REFERENCE   10 (bases 1 to 5753)
  AUTHORS   Singh,S.P., Mohamed,R., Salmond,C. and Lavin,M.F.
  TITLE     Reduced DNA topoisomerase II activity in ataxia-telangiectasia
            cells
  JOURNAL   Nucleic Acids Res. 16 (9), 3919-3929 (1988)
   PUBMED   2836804
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB069825.1, BC140791.1 and
            AC080112.15.
            This sequence is a reference standard in the RefSeqGene project.
            On Jul 7, 2010 this sequence version replaced gi:19913405.
            
            Summary: This gene encodes a DNA topoisomerase, an enzyme that
            controls and alters the topologic states of DNA during
            transcription. This nuclear enzyme is involved in processes such as
            chromosome condensation, chromatid separation, and the relief of
            torsional stress that occurs during DNA transcription and
            replication. It catalyzes the transient breaking and rejoining of
            two strands of duplex DNA which allows the strands to pass through
            one another, thus altering the topology of DNA. Two forms of this
            enzyme exist as likely products of a gene duplication event. The
            gene encoding this form, alpha, is localized to chromosome 17 and
            the beta gene is localized to chromosome 3. The gene encoding this
            enzyme functions as the target for several anticancer agents and a
            variety of mutations in this gene have been associated with the
            development of drug resistance. Reduced activity of this enzyme may
            also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul
            2010].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC140791.1, J04088.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-130               DB069825.1         1-130
            131-4755            BC140791.1         1-4625
            4756-5753           AC080112.15        34180-35177
FEATURES             Location/Qualifiers
     source          1..5753
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q21-q22"
     gene            1..5753
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="topoisomerase (DNA) II alpha 170kDa"
                     /db_xref="GeneID:7153"
                     /db_xref="HGNC:11989"
                     /db_xref="HPRD:00536"
                     /db_xref="MIM:126430"
     exon            1..180
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    118..120
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="upstream in-frame stop codon"
     CDS             160..4755
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /EC_number="5.99.1.3"
                     /note="DNA gyrase; DNA topoisomerase (ATP-hydrolyzing);
                     DNA topoisomerase II, 170 kD; DNA topoisomerase II, alpha
                     isozyme"
                     /codon_start=1
                     /product="DNA topoisomerase 2-alpha"
                     /protein_id="NP_001058.2"
                     /db_xref="GI:19913406"
                     /db_xref="CCDS:CCDS45672.1"
                     /db_xref="GeneID:7153"
                     /db_xref="HGNC:11989"
                     /db_xref="HPRD:00536"
                     /db_xref="MIM:126430"
                     /translation="
MEVSPLQPVNENMQVNKIKKNEDAKKRLSVERIYQKKTQLEHILLRPDTYIGSVELVTQQMWVYDEDVGINYREVTFVPGLYKIFDEILVNAADNKQRDPKMSCIRVTIDPENNLISIWNNGKGIPVVEHKVEKMYVPALIFGQLLTSSNYDDDEKKVTGGRNGYGAKLCNIFSTKFTVETASREYKKMFKQTWMDNMGRAGEMELKPFNGEDYTCITFQPDLSKFKMQSLDKDIVALMVRRAYDIAGSTKDVKVFLNGNKLPVKGFRSYVDMYLKDKLDETGNSLKVIHEQVNHRWEVCLTMSEKGFQQISFVNSIATSKGGRHVDYVADQIVTKLVDVVKKKNKGGVAVKAHQVKNHMWIFVNALIENPTFDSQTKENMTLQPKSFGSTCQLSEKFIKAAIGCGIVESILNWVKFKAQVQLNKKCSAVKHNRIKGIPKLDDANDAGGRNSTECTLILTEGDSAKTLAVSGLGVVGRDKYGVFPLRGKILNVREASHKQIMENAEINNIIKIVGLQYKKNYEDEDSLKTLRYGKIMIMTDQDQDGSHIKGLLINFIHHNWPSLLRHRFLEEFITPIVKVSKNKQEMAFYSLPEFEEWKSSTPNHKKWKVKYYKGLGTSTSKEAKEYFADMKRHRIQFKYSGPEDDAAISLAFSKKQIDDRKEWLTNFMEDRRQRKLLGLPEDYLYGQTTTYLTYNDFINKELILFSNSDNERSIPSMVDGLKPGQRKVLFTCFKRNDKREVKVAQLAGSVAEMSSYHHGEMSLMMTIINLAQNFVGSNNLNLLQPIGQFGTRLHGGKDSASPRYIFTMLSSLARLLFPPKDDHTLKFLYDDNQRVEPEWYIPIIPMVLINGAEGIGTGWSCKIPNFDVREIVNNIRRLMDGEEPLPMLPSYKNFKGTIEELAPNQYVISGEVAILNSTTIEISELPVRTWTQTYKEQVLEPMLNGTEKTPPLITDYREYHTDTTVKFVVKMTEEKLAEAERVGLHKVFKLQTSLTCNSMVLFDHVGCLKKYDTVLDILRDFFELRLKYYGLRKEWLLGMLGAESAKLNNQARFILEKIDGKIIIENKPKKELIKVLIQRGYDSDPVKAWKEAQQKVPDEEENEESDNEKETEKSDSVTDSGPTFNYLLDMPLWYLTKEKKDELCRLRNEKEQELDTLKRKSPSDLWKEDLATFIEELEAVEAKEKQDEQVGLPGKGGKAKGKKTQMAEVLPSPRGQRVIPRITIEMKAEAEKKNKKKIKNENTEGSPQEDGVELEGLKQRLEKKQKREPGTKTKKQTTLAFKPIKKGKKRNPWSDSESDRSSDESNFDVPPRETEPRRAATKTKFTMDLDSDEDFSDFDEKTDDEDFVPSDASPPKTKTSPKLSNKELKPQKSVVSDLEADDVKGSVPLSSSPPATHFPDETEITNPVPKKNVTVKKTAAKSQSSTSTTGAKKRAAPKGTKRDPALNSGVSQKPDPAKTKNRRKRKPSTSDDSDSNFEKIVSKAVTSKKSKGESDDFHMDFDSAVAPRAKSVRAKKPIKYLEESDEDDLF
"
     misc_feature    160..162
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylmethionine; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); acetylation site"
     misc_feature    169..171
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    244..3696
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="DNA topoisomerase 2; Provisional; Region: PLN03128"
                     /db_xref="CDD:178674"
     misc_feature    244..246
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    244..246
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01498"
     misc_feature    244..246
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01499"
     misc_feature    244..246
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:01502"
     misc_feature    400..>681
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="Histidine kinase-like ATPases; This family includes
                     several ATP-binding proteins for example: histidine
                     kinase, DNA gyrase B, topoisomerases, heat shock protein
                     HSP90, phytochrome-like ATPases and DNA mismatch repair
                     proteins; Region: HATPase_c; cd00075"
                     /db_xref="CDD:28956"
     misc_feature    order(418..420,430..432,439..441,511..513,517..519,
                     523..525,529..534,649..660)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:28956"
     misc_feature    430..432
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="Mg2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28956"
     misc_feature    order(523..525,529..531,649..651,655..657)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="G-X-G motif; other site"
                     /db_xref="CDD:28956"
     misc_feature    952..1410
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="TopoIIA_Trans_ScTopoIIA: Transducer domain, having
                     a ribosomal S5 domain 2-like fold, of the type found in
                     proteins of the type IIA family of DNA topoisomerases
                     similar to Saccharomyces cerevisiae Topo IIA.  S.
                     cerevisiae Topo IIA is a homodimer encoded...; Region:
                     TopoIIA_Trans_ScTopoIIA; cd03481"
                     /db_xref="CDD:48469"
     misc_feature    1003..1005
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
     misc_feature    1183..1191
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11388.3);
                     Region: Interaction with DNA (Probable)"
     misc_feature    order(1222..1224,1234..1236,1279..1284)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:48469"
     misc_feature    order(1285..1287,1291..1293)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="ATP binding [chemical binding]; other site"
                     /db_xref="CDD:48469"
     misc_feature    1522..1884
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="TOPRIM_TopoIIA: topoisomerase-primase (TOPRIM)
                     nucleotidyl transferase/hydrolase domain of the type found
                     in proteins of the type IIA family of DNA topoisomerases
                     similar to Saccharomyces cerevisiae Topoisomerase II.
                     TopoIIA enzymes cut both strands of...; Region:
                     TOPRIM_TopoIIA; cd03365"
                     /db_xref="CDD:173785"
     misc_feature    order(1540..1545,1552..1554,1780..1782,1786..1788,
                     1792..1794)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="active site"
                     /db_xref="CDD:173785"
     misc_feature    order(1540..1542,1780..1782)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="putative metal-binding site [ion binding]; other
                     site"
                     /db_xref="CDD:173785"
     misc_feature    1624..1626
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Interaction with DNA (By similarity); propagated
                     from UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    1633..1635
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2140..2142
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2143..2145
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2290..3681
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="DNA Topoisomerase, subtype IIA; domain A';
                     bacterial DNA topoisomerase IV (C subunit, ParC),
                     bacterial DNA gyrases (A subunit, GyrA),mammalian DNA
                     toposiomerases II. DNA topoisomerases are essential
                     enzymes that regulate the conformational changes in
                     DNA...; Region: TOP4c; cd00187"
                     /db_xref="CDD:29149"
     misc_feature    order(2290..2370,2377..2424,2428..2484,2491..2535,
                     2545..2601,2605..2652,2653..2673,2680..2682)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="CAP-like domain; other site"
                     /db_xref="CDD:29149"
     misc_feature    2326..2328
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2428..2430
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2446..2448
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2569..2571
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Transition state stabilizer (By similarity);
                     propagated from UniProtKB/Swiss-Prot (P11388.3); other
                     site"
     misc_feature    2572..2574
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="active site"
                     /db_xref="CDD:29149"
     misc_feature    2725..2727
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="Important for DNA bending, intercalates between
                     base pairs of target DNA (By similarity); propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    2950..2952
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Interaction with DNA; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); other site"
     misc_feature    3127..3156
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11388.3);
                     Region: Interaction with DNA"
     misc_feature    3211..3243
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P11388.3);
                     Region: Nuclear export signal"
     misc_feature    order(3325..3333,3340..3345,3367..3372,3535..3585)
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="primary dimer interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:29149"
     misc_feature    3475..3477
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CK1; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
     misc_feature    3475..3477
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3772..3774
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
     misc_feature    3796..3798
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    3796..3798
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    3796..3798
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3796..3798
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3898..3900
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    3898..3900
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    3898..3900
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4042..4044
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4042..4044
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4048..4050
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4048..4050
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4054..4056
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4063..4065
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4153..4155
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4168..4170
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4186..4188
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by PLK3; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
     misc_feature    4186..4188
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00277"
     misc_feature    4210..4212
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4210..4212
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4219..4221
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4219..4221
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    4219..4221
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4240..4242
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    4279..4281
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4288..4290
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4288..4290
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00277"
     misc_feature    4288..4290
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4318..4320
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4318..4320
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4333..4335
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4336..4338
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4336..4338
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00302"
     misc_feature    4462..4728
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /note="DTHCT (NUC029) region; Region: DTHCT; pfam08070"
                     /db_xref="CDD:149254"
     misc_feature    4504..4506
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4564..4566
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CK2; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
     misc_feature    4564..4566
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00277"
     misc_feature    4564..4566
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4567..4569
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P11388.3); phosphorylation site"
     misc_feature    4570..4572
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4579..4581
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4579..4581
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    4585..4587
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4642..4644
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4669..4671
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4732..4734
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P11388.3); phosphorylation site"
     misc_feature    4732..4734
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00277"
     misc_feature    4732..4734
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     exon            181..336
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            337..427
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            428..491
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            492..637
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            638..735
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            736..948
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            949..1122
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1123..1224
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1225..1362
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1363..1501
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1502..1659
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1660..1785
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1786..1896
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            1897..2002
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2003..2112
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2113..2205
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2206..2320
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2321..2442
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2443..2591
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2592..2823
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2824..2958
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            2959..3159
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            3160..3355
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            3356..3447
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            3448..3612
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            3613..3696
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            3697..3879
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     variation       3749
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1804537"
     variation       3765
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1061692"
     variation       3858
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1141364"
     exon            3880..3970
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            3971..4123
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     variation       4093
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804538"
     STS             4110..4290
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /standard_name="D17S1435E"
                     /db_xref="UniSTS:150473"
     exon            4124..4247
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     variation       4130
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:28969502"
     exon            4248..4291
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            4292..4426
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     exon            4427..4626
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     variation       4571
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804539"
     exon            4627..5753
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /inference="alignment:Splign:1.39.8"
     STS             4637..4865
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /standard_name="GDB:180937"
                     /db_xref="UniSTS:155131"
     variation       4702
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11540720"
     STS             4756..4908
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /standard_name="SHGC-12497"
                     /db_xref="UniSTS:6329"
     STS             5249..5520
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /standard_name="RH17658"
                     /db_xref="UniSTS:7622"
     variation       5333
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13695"
     STS             5542..5667
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /standard_name="SHGC-31685"
                     /db_xref="UniSTS:70696"
     variation       5563
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1064288"
     polyA_signal    5726..5731
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
     polyA_site      5753
                     /gene="TOP2A"
                     /gene_synonym="TOP2; TP2A"
ORIGIN      
gattggctggtctgcttcgggcgggctaaaggaaggttcaagtggagctctcctaaccgacgcgcgtctgtggagaagcggcttggtcgggggtggtctcgtggggtcctgcctgtttagtcgctttcagggttcttgagccccttcacgaccgtcaccatggaagtgtcaccattgcagcctgtaaatgaaaatatgcaagtcaacaaaataaagaaaaatgaagatgctaagaaaagactgtctgttgaaagaatctatcaaaagaaaacacaattggaacatattttgctccgcccagacacctacattggttctgtggaattagtgacccagcaaatgtgggtttacgatgaagatgttggcattaactatagggaagtcacttttgttcctggtttgtacaaaatctttgatgagattctagttaatgctgcggacaacaaacaaagggacccaaaaatgtcttgtattagagtcacaattgatccggaaaacaatttaattagtatatggaataatggaaaaggtattcctgttgttgaacacaaagttgaaaagatgtatgtcccagctctcatatttggacagctcctaacttctagtaactatgatgatgatgaaaagaaagtgacaggtggtcgaaatggctatggagccaaattgtgtaacatattcagtaccaaatttactgtggaaacagccagtagagaatacaagaaaatgttcaaacagacatggatggataatatgggaagagctggtgagatggaactcaagcccttcaatggagaagattatacatgtatcacctttcagcctgatttgtctaagtttaaaatgcaaagcctggacaaagatattgttgcactaatggtcagaagagcatatgatattgctggatccaccaaagatgtcaaagtctttcttaatggaaataaactgccagtaaaaggatttcgtagttatgtggacatgtatttgaaggacaagttggatgaaactggtaactccttgaaagtaatacatgaacaagtaaaccacaggtgggaagtgtgtttaactatgagtgaaaaaggctttcagcaaattagctttgtcaacagcattgctacatccaagggtggcagacatgttgattatgtagctgatcagattgtgactaaacttgttgatgttgtgaagaagaagaacaagggtggtgttgcagtaaaagcacatcaggtgaaaaatcacatgtggatttttgtaaatgccttaattgaaaacccaacctttgactctcagacaaaagaaaacatgactttacaacccaagagctttggatcaacatgccaattgagtgaaaaatttatcaaagctgccattggctgtggtattgtagaaagcatactaaactgggtgaagtttaaggcccaagtccagttaaacaagaagtgttcagctgtaaaacataatagaatcaagggaattcccaaactcgatgatgccaatgatgcagggggccgaaactccactgagtgtacgcttatcctgactgagggagattcagccaaaactttggctgtttcaggccttggtgtggttgggagagacaaatatggggttttccctcttagaggaaaaatactcaatgttcgagaagcttctcataagcagatcatggaaaatgctgagattaacaatatcatcaagattgtgggtcttcagtacaagaaaaactatgaagatgaagattcattgaagacgcttcgttatgggaagataatgattatgacagatcaggaccaagatggttcccacatcaaaggcttgctgattaattttatccatcacaactggccctctcttctgcgacatcgttttctggaggaatttatcactcccattgtaaaggtatctaaaaacaagcaagaaatggcattttacagccttcctgaatttgaagagtggaagagttctactccaaatcataaaaaatggaaagtcaaatattacaaaggtttgggcaccagcacatcaaaggaagctaaagaatactttgcagatatgaaaagacatcgtatccagttcaaatattctggtcctgaagatgatgctgctatcagcctggcctttagcaaaaaacagatagatgatcgaaaggaatggttaactaatttcatggaggatagaagacaacgaaagttacttgggcttcctgaggattacttgtatggacaaactaccacatatctgacatataatgacttcatcaacaaggaacttatcttgttctcaaattctgataacgagagatctatcccttctatggtggatggtttgaaaccaggtcagagaaaggttttgtttacttgcttcaaacggaatgacaagcgagaagtaaaggttgcccaattagctggatcagtggctgaaatgtcttcttatcatcatggtgagatgtcactaatgatgaccattatcaatttggctcagaattttgtgggtagcaataatctaaacctcttgcagcccattggtcagtttggtaccaggctacatggtggcaaggattctgctagtccacgatacatctttacaatgctcagctctttggctcgattgttatttccaccaaaagatgatcacacgttgaagtttttatatgatgacaaccagcgtgttgagcctgaatggtacattcctattattcccatggtgctgataaatggtgctgaaggaatcggtactgggtggtcctgcaaaatccccaactttgatgtgcgtgaaattgtaaataacatcaggcgtttgatggatggagaagaacctttgccaatgcttccaagttacaagaacttcaagggtactattgaagaactggctccaaatcaatatgtgattagtggtgaagtagctattcttaattctacaaccattgaaatctcagagcttcccgtcagaacatggacccagacatacaaagaacaagttctagaacccatgttgaatggcaccgagaagacacctcctctcataacagactatagggaataccatacagataccactgtgaaatttgttgtgaagatgactgaagaaaaactggcagaggcagagagagttggactacacaaagtcttcaaactccaaactagtctcacatgcaactctatggtgctttttgaccacgtaggctgtttaaagaaatatgacacggtgttggatattctaagagacttttttgaactcagacttaaatattatggattaagaaaagaatggctcctaggaatgcttggtgctgaatctgctaaactgaataatcaggctcgctttatcttagagaaaatagatggcaaaataatcattgaaaataagcctaagaaagaattaattaaagttctgattcagaggggatatgattcggatcctgtgaaggcctggaaagaagcccagcaaaaggttccagatgaagaagaaaatgaagagagtgacaacgaaaaggaaactgaaaagagtgactccgtaacagattctggaccaaccttcaactatcttcttgatatgcccctttggtatttaaccaaggaaaagaaagatgaactctgcaggctaagaaatgaaaaagaacaagagctggacacattaaaaagaaagagtccatcagatttgtggaaagaagacttggctacatttattgaagaattggaggctgttgaagccaaggaaaaacaagatgaacaagtcggacttcctgggaaaggggggaaggccaaggggaaaaaaacacaaatggctgaagttttgccttctccgcgtggtcaaagagtcattccacgaataaccatagaaatgaaagcagaggcagaaaagaaaaataaaaagaaaattaagaatgaaaatactgaaggaagccctcaagaagatggtgtggaactagaaggcctaaaacaaagattagaaaagaaacagaaaagagaaccaggtacaaagacaaagaaacaaactacattggcatttaagccaatcaaaaaaggaaagaagagaaatccctggtctgattcagaatcagataggagcagtgacgaaagtaattttgatgtccctccacgagaaacagagccacggagagcagcaacaaaaacaaaattcacaatggatttggattcagatgaagatttctcagattttgatgaaaaaactgatgatgaagattttgtcccatcagatgctagtccacctaagaccaaaacttccccaaaacttagtaacaaagaactgaaaccacagaaaagtgtcgtgtcagaccttgaagctgatgatgttaagggcagtgtaccactgtcttcaagccctcctgctacacatttcccagatgaaactgaaattacaaacccagttcctaaaaagaatgtgacagtgaagaagacagcagcaaaaagtcagtcttccacctccactaccggtgccaaaaaaagggctgccccaaaaggaactaaaagggatccagctttgaattctggtgtctctcaaaagcctgatcctgccaaaaccaagaatcgccgcaaaaggaagccatccacttctgatgattctgactctaattttgagaaaattgtttcgaaagcagtcacaagcaagaaatccaagggggagagtgatgacttccatatggactttgactcagctgtggctcctcgggcaaaatctgtacgggcaaagaaacctataaagtacctggaagagtcagatgaagatgatctgttttaaaatgtgaggcgattattttaagtaattatcttaccaagcccaagactggttttaaagttacctgaagctcttaacttcctcccctctgaatttagtttggggaaggtgtttttagtacaagacatcaaagtgaagtaaagcccaagtgttctttagctttttataatactgtctaaatagtgaccatctcatgggcattgttttcttctctgctttgtctgtgttttgagtctgctttcttttgtctttaaaacctgatttttaagttcttctgaactgtagaaatagctatctgatcacttcagcgtaaagcagtgtgtttattaaccatccactaagctaaaactagagcagtttgatttaaaagtgtcactcttcctccttttctactttcagtagatatgagatagagcataattatctgttttatcttagttttatacataatttaccatcagatagaactttatggttctagtacagatactctactacactcagcctcttatgtgccaagtttttctttaagcaatgagaaattgctcatgttcttcatcttctcaaatcatcagaggccgaagaaaaacactttggctgtgtctataacttgacacagtcaatagaatgaagaaaattagagtagttatgtgattatttcagctcttgacctgtcccctctggctgcctctgagtctgaatctcccaaagagagaaaccaatttctaagaggactggattgcagaagactcggggacaacatttgatccaagatcttaaatgttatattgataaccatgctcagcaatgagctattagattcattttgggaaatctccataatttcaatttgtaaactttgttaagacctgtctacattgttatatgtgtgtgacttgagtaatgttatcaacgtttttgtaaatatttactatgtttttctattagctaaattccaacaattttgtactttaataaaatgttctaaacattgcaaccca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7153 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0003677 [DNA binding] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0003918 [DNA topoisomerase type II (ATP-hydrolyzing) activity] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0005080 [protein kinase C binding] evidence: IPI
            GeneID:7153 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:7153 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:7153 -> Molecular function: GO:0008022 [protein C-terminus binding] evidence: IPI
            GeneID:7153 -> Molecular function: GO:0008094 [DNA-dependent ATPase activity] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0008144 [drug binding] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0008301 [DNA binding, bending] evidence: IDA
            GeneID:7153 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:7153 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:7153 -> Molecular function: GO:0042826 [histone deacetylase binding] evidence: IPI
            GeneID:7153 -> Molecular function: GO:0043130 [ubiquitin binding] evidence: IMP
            GeneID:7153 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IPI
            GeneID:7153 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:7153 -> Biological process: GO:0000712 [resolution of meiotic recombination intermediates] evidence: IBA
            GeneID:7153 -> Biological process: GO:0000819 [sister chromatid segregation] evidence: IBA
            GeneID:7153 -> Biological process: GO:0006260 [DNA replication] evidence: NAS
            GeneID:7153 -> Biological process: GO:0006261 [DNA-dependent DNA replication] evidence: IBA
            GeneID:7153 -> Biological process: GO:0006265 [DNA topological change] evidence: IBA
            GeneID:7153 -> Biological process: GO:0006265 [DNA topological change] evidence: IDA
            GeneID:7153 -> Biological process: GO:0006266 [DNA ligation] evidence: IDA
            GeneID:7153 -> Biological process: GO:0006281 [DNA repair] evidence: NAS
            GeneID:7153 -> Biological process: GO:0006312 [mitotic recombination] evidence: IBA
            GeneID:7153 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
            GeneID:7153 -> Biological process: GO:0007059 [chromosome segregation] evidence: IMP
            GeneID:7153 -> Biological process: GO:0030263 [apoptotic chromosome condensation] evidence: IDA
            GeneID:7153 -> Biological process: GO:0040016 [embryonic cleavage] evidence: IEA
            GeneID:7153 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
            GeneID:7153 -> Biological process: GO:0045070 [positive regulation of viral genome replication] evidence: IMP
            GeneID:7153 -> Biological process: GO:0045870 [positive regulation of retroviral genome replication] evidence: IMP
            GeneID:7153 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:7153 -> Biological process: GO:0048015 [phosphatidylinositol-mediated signaling] evidence: NAS
            GeneID:7153 -> Cellular component: GO:0000228 [nuclear chromosome] evidence: IDA
            GeneID:7153 -> Cellular component: GO:0000795 [synaptonemal complex] evidence: IBA
            GeneID:7153 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:7153 -> Cellular component: GO:0005654 [nucleoplasm] evidence: IDA
            GeneID:7153 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:7153 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:7153 -> Cellular component: GO:0005814 [centriole] evidence: IDA
            GeneID:7153 -> Cellular component: GO:0009295 [nucleoid] evidence: IBA
            GeneID:7153 -> Cellular component: GO:0009330 [DNA topoisomerase complex (ATP-hydrolyzing)] evidence: IDA
            GeneID:7153 -> Cellular component: GO:0019035 [viral integration complex] evidence: NAS
            GeneID:7153 -> Cellular component: GO:0043234 [protein complex] evidence: IPI
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_001058 -> EC 5.99.1.3

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.