Home |
Help |
Advanced search
2024-04-18 18:59:48, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001023571 2195 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens IQ motif containing B1 (IQCB1), transcript variant 3,
mRNA.
ACCESSION NM_001023571
VERSION NM_001023571.2 GI:170014679
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2195)
AUTHORS Fahim,A.T., Bowne,S.J., Sullivan,L.S., Webb,K.D., Williams,J.T.,
Wheaton,D.K., Birch,D.G. and Daiger,S.P.
TITLE Polymorphic variation of RPGRIP1L and IQCB1 as modifiers of
X-linked retinitis pigmentosa caused by mutations in RPGR
JOURNAL Adv. Exp. Med. Biol. 723, 313-320 (2012)
PUBMED 22183348
REMARK GeneRIF: Genetic variation may affect severity of disease for
X-linked retinitis pigmentosa.
REFERENCE 2 (bases 1 to 2195)
AUTHORS Wang,X., Wang,H., Cao,M., Li,Z., Chen,X., Patenia,C., Gore,A.,
Abboud,E.B., Al-Rajhi,A.A., Lewis,R.A., Lupski,J.R., Mardon,G.,
Zhang,K., Muzny,D., Gibbs,R.A. and Chen,R.
TITLE Whole-exome sequencing identifies ALMS1, IQCB1, CNGA3, and MYO7A
mutations in patients with Leber congenital amaurosis
JOURNAL Hum. Mutat. 32 (12), 1450-1459 (2011)
PUBMED 21901789
REMARK GeneRIF: in a set of consanguineous patient families with Leber
congenital amaurosis study identified five putative disease-causing
mutations, including four novel alleles, in six families; These
five mutations are located in four genes, ALMS1, IQCB1, CNGA3, and
MYO7A
REFERENCE 3 (bases 1 to 2195)
AUTHORS Cideciyan,A.V., Rachel,R.A., Aleman,T.S., Swider,M., Schwartz,S.B.,
Sumaroka,A., Roman,A.J., Stone,E.M., Jacobson,S.G. and Swaroop,A.
TITLE Cone photoreceptors are the main targets for gene therapy of NPHP5
(IQCB1) or NPHP6 (CEP290) blindness: generation of an all-cone
Nphp6 hypomorph mouse that mimics the human retinal ciliopathy
JOURNAL Hum. Mol. Genet. 20 (7), 1411-1423 (2011)
PUBMED 21245082
REMARK GeneRIF: Cone photoreceptors are the main targets for gene therapy
of NPHP5 (IQCB1) or NPHP6 (CEP290) blindness: generation of an
all-cone Nphp6 hypomorph mouse that mimics the human retinal
ciliopathy.
REFERENCE 4 (bases 1 to 2195)
AUTHORS Stone,E.M., Cideciyan,A.V., Aleman,T.S., Scheetz,T.E., Sumaroka,A.,
Ehlinger,M.A., Schwartz,S.B., Fishman,G.A., Traboulsi,E.I.,
Lam,B.L., Fulton,A.B., Mullins,R.F., Sheffield,V.C. and
Jacobson,S.G.
TITLE Variations in NPHP5 in patients with nonsyndromic leber congenital
amaurosis and Senior-Loken syndrome
JOURNAL Arch. Ophthalmol. 129 (1), 81-87 (2011)
PUBMED 21220633
REMARK GeneRIF: Mutations in NPHP5 can cause Leber congenital amaurosis
(LCA)without early-onset renal disease.
REFERENCE 5 (bases 1 to 2195)
AUTHORS Fahim,A.T., Bowne,S.J., Sullivan,L.S., Webb,K.D., Williams,J.T.,
Wheaton,D.K., Birch,D.G. and Daiger,S.P.
TITLE Allelic heterogeneity and genetic modifier loci contribute to
clinical variation in males with X-linked retinitis pigmentosa due
to RPGR mutations
JOURNAL PLoS ONE 6 (8), E23021 (2011)
PUBMED 21857984
REMARK GeneRIF: Data show that the minor allele (N) of I393N in IQCB1 and
the common allele (R) of R744Q in RPGRIP1L were associated with
severe disease in XlRP with RPGR mutations.
REFERENCE 6 (bases 1 to 2195)
AUTHORS Luo,X., He,Q., Huang,Y. and Sheikh,M.S.
TITLE Cloning and characterization of a p53 and DNA damage down-regulated
gene PIQ that codes for a novel calmodulin-binding IQ motif protein
and is up-regulated in gastrointestinal cancers
JOURNAL Cancer Res. 65 (23), 10725-10733 (2005)
PUBMED 16322217
REFERENCE 7 (bases 1 to 2195)
AUTHORS le Maire,A., Weber,T., Saunier,S., Broutin,I., Antignac,C.,
Ducruix,A. and Dardel,F.
TITLE Solution NMR structure of the SH3 domain of human nephrocystin and
analysis of a mutation-causing juvenile nephronophthisis
JOURNAL Proteins 59 (2), 347-355 (2005)
PUBMED 15723349
REFERENCE 8 (bases 1 to 2195)
AUTHORS Mollet,G., Silbermann,F., Delous,M., Salomon,R., Antignac,C. and
Saunier,S.
TITLE Characterization of the nephrocystin/nephrocystin-4 complex and
subcellular localization of nephrocystin-4 to primary cilia and
centrosomes
JOURNAL Hum. Mol. Genet. 14 (5), 645-656 (2005)
PUBMED 15661758
REFERENCE 9 (bases 1 to 2195)
AUTHORS Otto,E.A., Loeys,B., Khanna,H., Hellemans,J., Sudbrak,R., Fan,S.,
Muerb,U., O'Toole,J.F., Helou,J., Attanasio,M., Utsch,B.,
Sayer,J.A., Lillo,C., Jimeno,D., Coucke,P., De Paepe,A.,
Reinhardt,R., Klages,S., Tsuda,M., Kawakami,I., Kusakabe,T.,
Omran,H., Imm,A., Tippens,M., Raymond,P.A., Hill,J., Beales,P.,
He,S., Kispert,A., Margolis,B., Williams,D.S., Swaroop,A. and
Hildebrandt,F.
TITLE Nephrocystin-5, a ciliary IQ domain protein, is mutated in
Senior-Loken syndrome and interacts with RPGR and calmodulin
JOURNAL Nat. Genet. 37 (3), 282-288 (2005)
PUBMED 15723066
REMARK GeneRIF: nephrocystin-5, RPGR and calmodulin can be
coimmunoprecipitated from retinal extracts, and that these proteins
localize to connecting cilia of photoreceptors and to primary cilia
of renal epithelial cells
REFERENCE 10 (bases 1 to 2195)
AUTHORS Mollet,G., Salomon,R., Gribouval,O., Silbermann,F., Bacq,D.,
Landthaler,G., Milford,D., Nayir,A., Rizzoni,G., Antignac,C. and
Saunier,S.
TITLE The gene mutated in juvenile nephronophthisis type 4 encodes a
novel protein that interacts with nephrocystin
JOURNAL Nat. Genet. 32 (2), 300-305 (2002)
PUBMED 12244321
REMARK Erratum:[Nat Genet 2002 Nov;32(3):459]
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BG721354.1, BC005806.2,
AY964668.1, BX393165.2, AL042102.1 and D25278.1.
On Mar 15, 2008 this sequence version replaced gi:66571279.
Summary: This gene encodes a nephrocystin protein that interacts
with calmodulin and the retinitis pigmentosa GTPase regulator
protein. The encoded protein has a central coiled-coil region and
two calmodulin-binding IQ domains. It is localized to the primary
cilia of renal epithelial cells and connecting cilia of
photoreceptor cells. The protein is thought to play a role in
ciliary function. Defects in this gene result in Senior-Loken
syndrome type 5. Alternative splicing results in multiple
transcript variants. [provided by RefSeq, Nov 2009].
Transcript Variant: This variant (3) lacks alternate in-frame exons
in the CDS, compared to variant 1. The encoded isoform (c) is
shorter, compared to isoform a.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AY964667.1, BC005806.2 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-53 BG721354.1 12-64
54-68 BC005806.2 1-15
69-203 AY964668.1 8-142
204-788 BC005806.2 145-729
789-802 AY964668.1 727-740
803-1116 BC005806.2 744-1057
1117-1613 AY964668.1 1454-1950
1614-1809 BC005806.2 1555-1750
1810-2156 BX393165.2 39-385 c
2157-2173 AL042102.1 207-223
2174-2195 D25278.1 2514-2535
FEATURES Location/Qualifiers
source 1..2195
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3q13.33"
gene 1..2195
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/note="IQ motif containing B1"
/db_xref="GeneID:9657"
/db_xref="HGNC:28949"
/db_xref="MIM:609237"
exon 1..114
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
misc_feature 111..113
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/note="upstream in-frame stop codon"
exon 115..203
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
exon 204..315
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
CDS 216..1613
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/note="isoform c is encoded by transcript variant 3; IQ
calmodulin-binding motif containing 1; p53 and DNA
damage-regulated IQ motif protein; IQ calmodulin-binding
motif-containing protein 1; nephrocystin 5"
/codon_start=1
/product="IQ calmodulin-binding motif-containing protein 1
isoform c"
/protein_id="NP_001018865.2"
/db_xref="GI:170014680"
/db_xref="CCDS:CCDS33836.1"
/db_xref="GeneID:9657"
/db_xref="HGNC:28949"
/db_xref="MIM:609237"
/translation="
MKPTGTDPRILSIAAEVAKSPEQNVPVILLKLKEIINITPLGSSELKKIKQDIYCYDLIQYCLLVLSQDYSRIQGGWTTISQLTQILSHCCVGLEPGEDAEEFYNELLPSAAENFLVLGRQLQTCFINAAKAEEKDELLHFFQIVTDSLFWLLGGHVELIQNVLQSDHFLHLLQADNVQIGSAVMMMLQNILQINRSKRSKMLLEINRQKEEEDLKLQLQLQRQRAMRLSRELQLSMLEIVHPGQVEKHYREMEEKSALIIQKHWRGYRERKNFHQQRQSLIEYKAAVTLQRAALKFLAKCRKKKKLFAPWRGLQELTDARRVELKKRVDDYVRRHLGSPMSDVVSRELHAQAQERLQHYFMGRALEERAQQHREALIAQISTNVEQLMKAPSLKEAEGKEPELFLSRSRPVAAKAKQAHLTTLKHIQAPWWKKLGEESGDEIDVPKDELSIELENLFIGGTKPP
"
misc_feature 975..1040
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/note="Calmodulin-binding motif; Region: IQ; smart00015"
/db_xref="CDD:197470"
exon 316..478
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
exon 479..608
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
exon 609..702
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
exon 703..802
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
exon 803..945
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
exon 946..1094
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
variation 994
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/replace="a"
/replace="t"
/db_xref="dbSNP:1141528"
exon 1095..1226
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
STS 1106..1260
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/standard_name="RH25274"
/db_xref="UniSTS:32769"
exon 1227..1383
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
STS 1235..1500
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/standard_name="D6S2310"
/db_xref="UniSTS:6299"
exon 1384..2195
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/inference="alignment:Splign:1.39.8"
STS 1418..2056
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/standard_name="IQCB1_8973"
/db_xref="UniSTS:468484"
STS 1654..1756
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/standard_name="WI-9285"
/db_xref="UniSTS:12591"
variation 1810
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
/replace="c"
/replace="g"
/db_xref="dbSNP:1135750"
polyA_signal 2175..2180
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
polyA_site 2195
/gene="IQCB1"
/gene_synonym="NPHP5; PIQ; SLSN5"
ORIGIN
cgcctccaggccccttcccgcgtcgcgacgcacgctgccccggaaggccgcggcgctgtagtgcggcgtgggagccccaggttctttagtggaagaacgcgaagcgaggatgagtgatccgtggaggcagtaacaggcgcggcgagggagaagtgattcccgaagaatcaaggctgggccggacccggtggcctggcaacagggtaataagagaaatgaagccaacaggtacagacccaaggatcttatctatagctgctgaagttgcaaaaagccctgagcagaatgtccctgttatactgttgaagttaaaagaaataataaacatcacacctttaggaagctcagagttgaagaaaatcaaacaagatatatattgttatgatctcattcaatattgcctcttggtcctcagtcaagattattctcgaatccagggtggttggactacaatttcccagcttacacagatattaagccattgctgtgtgggcttggagccaggagaagatgcagaggaattttacaatgaattacttccatcagctgcagaaaattttctagttttggggagacaattacaaacatgttttatcaatgcagctaaggctgaagaaaaagatgaattactacactttttccaaattgtgactgattctctcttctggcttttgggaggccatgttgaacttattcagaatgtactacaaagtgatcatttcttacatttactgcaagctgacaatgtccaaataggatctgcagtcatgatgatgctacagaatatactacagatcaacagatccaaacgatcaaagatgttgctggagataaataggcagaaggaagaagaggacctcaaattacaattgcaacttcaaagacagagagccatgagactttcccgagaattgcagctgagtatgctcgaaatagttcatccaggtcaggtggagaaacactatcgggaaatggaagagaaatcagcactgattatccagaaacattggagagggtacagggaaaggaaaaattttcaccaacagaggcagtctctcatagagtataaagcagctgtcacacttcaaagagcagcgcttaaattcctagcgaagtgccgtaagaaaaagaaactatttgctccttggcgaggactccaagaactcactgatgcacgccgagttgaactgaagaaacgagtggatgactatgtcagaagacatttgggctctccaatgtcagatgtggtcagtagggagctccatgcccaagctcaagaacgactgcaacactactttatgggcagggccctagaagagcgagcccagcagcacagagaagctctgatagcacagatcagcaccaacgttgaacagctaatgaaggcaccaagtctgaaggaggcagaagggaaagaacctgagctcttcctaagtagatccaggcctgtggcagccaaggccaagcaggcccatctcacaaccctgaagcacatacaagcaccctggtggaagaagcttggagaagaatctggagatgagattgatgttccaaaggatgagcttagtatagaattagaaaatttattcattggtggaaccaaaccaccttagtgagtaaccctaagaattgacacaaatctcatattttaggagattatattggttctgcctctggcatgctggtagactagggccatcctaacttattattttccagaggttctcctccagacaagacctgcagtaagcaaagagttatattctacctctctctcaattttctttttcttttctctgtatcctcatcgttagccacacacagatttgtgtggcttttattgtagaactaaacttagcatagtgttctgttgtttacatgaagtgtgtttttctttggtttcttctgttttccaactaaatatttttttctaaataaatattttcaacaattgatttgaaaaatttgtcaggattatttcaacttttcacatttgttatctgaaattcctatttcctgttaacataggaggtgtgtgcagactttattaatgtgaggaaaagaaatgctcaattgaaggacatttccctgttttctataaagcaatggttgaactcattttctattttgttatttctaaaaggaactgcataccaaaaaaatgcattctttctattaaactgtgagaactacat
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9657 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:9657 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IDA
GeneID:9657 -> Biological process: GO:0042384 [cilium assembly] evidence: ISS
GeneID:9657 -> Biological process: GO:0045494 [photoreceptor cell maintenance] evidence: IMP
GeneID:9657 -> Biological process: GO:0048496 [maintenance of organ identity] evidence: IMP
GeneID:9657 -> Cellular component: GO:0001750 [photoreceptor outer segment] evidence: IEA
GeneID:9657 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:9657 -> Cellular component: GO:0005813 [centrosome] evidence: IDA
GeneID:9657 -> Cellular component: GO:0032391 [photoreceptor connecting cilium] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.