Home |
Help |
Advanced search
2024-04-19 08:09:38, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001006665 3112 bp mRNA linear PRI 16-JUN-2013
DEFINITION Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 1
(RPS6KA1), transcript variant 2, mRNA.
ACCESSION NM_001006665
VERSION NM_001006665.1 GI:55743133
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3112)
AUTHORS Zhang,X., Lavoie,G., Fort,L., Huttlin,E.L., Tcherkezian,J.,
Galan,J.A., Gu,H., Gygi,S.P., Carreno,S. and Roux,P.P.
TITLE Gab2 phosphorylation by RSK inhibits Shp2 recruitment and cell
motility
JOURNAL Mol. Cell. Biol. 33 (8), 1657-1670 (2013)
PUBMED 23401857
REMARK GeneRIF: results indicate that RSK directly phosphorylates Gab2 on
3 serine residues; findings show RSK-mediated Gab2 phosphorylation
inhibits Shp2 recruitment, suggesting RSK mediates a
negative-feedback loop that attenuates Gab2-dependent functions
including cell motility
REFERENCE 2 (bases 1 to 3112)
AUTHORS Park,Y.S. and Cho,N.J.
TITLE EGFR and PKC are involved in the activation of ERK1/2 and p90 RSK
and the subsequent proliferation of SNU-407 colon cancer cells by
muscarinic acetylcholine receptors
JOURNAL Mol. Cell. Biochem. 370 (1-2), 191-198 (2012)
PUBMED 22865467
REMARK GeneRIF: These data indicate that EGFR and PKC are involved in
mAChR-mediated activation of ERK1/2 and RSK and the subsequent
proliferation of SNU-407 colon cancer cells.
REFERENCE 3 (bases 1 to 3112)
AUTHORS Stratford,A.L., Reipas,K., Hu,K., Fotovati,A., Brough,R.,
Frankum,J., Takhar,M., Watson,P., Ashworth,A., Lord,C.J.,
Lasham,A., Print,C.G. and Dunn,S.E.
TITLE Targeting p90 ribosomal S6 kinase eliminates tumor-initiating cells
by inactivating Y-box binding protein-1 in triple-negative breast
cancers
JOURNAL Stem Cells 30 (7), 1338-1348 (2012)
PUBMED 22674792
REMARK GeneRIF: Targeting p90 ribosomal S6 kinase eliminates
tumor-initiating cells by inactivating Y-box binding protein-1 in
triple-negative breast cancers.
REFERENCE 4 (bases 1 to 3112)
AUTHORS Li,D., Fu,T.M., Nan,J., Liu,C., Li,L.F. and Su,X.D.
TITLE Structural basis for the autoinhibition of the C-terminal kinase
domain of human RSK1
JOURNAL Acta Crystallogr. D Biol. Crystallogr. 68 (PT 6), 680-685 (2012)
PUBMED 22683790
REMARK GeneRIF: structure indicates that activation of RSK1 involves the
removal of alpha-helix from the substrate-binding groove induced by
ERK1/2 phosphorylation
REFERENCE 5 (bases 1 to 3112)
AUTHORS Li,R., Chen,D.F., Zhou,R., Jia,S.N., Yang,J.S., Clegg,J.S. and
Yang,W.J.
TITLE Involvement of polo-like kinase 1 (Plk1) in mitotic arrest by
inhibition of mitogen-activated protein kinase-extracellular
signal-regulated kinase-ribosomal S6 kinase 1 (MEK-ERK-RSK1)
cascade
JOURNAL J. Biol. Chem. 287 (19), 15923-15934 (2012)
PUBMED 22427657
REMARK GeneRIF: Data indicate that Plk1 siRNA interference and
overexpression increased phosphorylation of RSK1, suggesting that
Plk1 inhibits RSK1.
REFERENCE 6 (bases 1 to 3112)
AUTHORS Moller,D.E., Xia,C.H., Tang,W., Zhu,A.X. and Jakubowski,M.
TITLE Human rsk isoforms: cloning and characterization of tissue-specific
expression
JOURNAL Am. J. Physiol. 266 (2 PT 1), C351-C359 (1994)
PUBMED 8141249
REFERENCE 7 (bases 1 to 3112)
AUTHORS Chen,R.H., Abate,C. and Blenis,J.
TITLE Phosphorylation of the c-Fos transrepression domain by
mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 90 (23), 10952-10956 (1993)
PUBMED 8248197
REFERENCE 8 (bases 1 to 3112)
AUTHORS Rivera,V.M., Miranti,C.K., Misra,R.P., Ginty,D.D., Chen,R.H.,
Blenis,J. and Greenberg,M.E.
TITLE A growth factor-induced kinase phosphorylates the serum response
factor at a site that regulates its DNA-binding activity
JOURNAL Mol. Cell. Biol. 13 (10), 6260-6273 (1993)
PUBMED 8413226
REFERENCE 9 (bases 1 to 3112)
AUTHORS Tratner,I., Ofir,R. and Verma,I.M.
TITLE Alteration of a cyclic AMP-dependent protein kinase phosphorylation
site in the c-Fos protein augments its transforming potential
JOURNAL Mol. Cell. Biol. 12 (3), 998-1006 (1992)
PUBMED 1545828
REFERENCE 10 (bases 1 to 3112)
AUTHORS Chen,R.H., Sarnecki,C. and Blenis,J.
TITLE Nuclear localization and regulation of erk- and rsk-encoded protein
kinases
JOURNAL Mol. Cell. Biol. 12 (3), 915-927 (1992)
PUBMED 1545823
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AK092955.1, BC014966.1 and
L07597.1.
Summary: This gene encodes a member of the RSK (ribosomal S6
kinase) family of serine/threonine kinases. This kinase contains 2
nonidentical kinase catalytic domains and phosphorylates various
substrates, including members of the mitogen-activated kinase
(MAPK) signalling pathway. The activity of this protein has been
implicated in controlling cell growth and differentiation.
Alternate transcriptional splice variants, encoding different
isoforms, have been characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) differs in the 5' UTR and 5'
end of the coding region, compared to variant 1. These differences
cause translation initiation at an in-frame ATG of an alternate
exon and an isoform (b) with a distinct N-terminus compared to
isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK292722.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-544 AK092955.1 11-554
545-547 AK092955.1 634-636
548-2325 BC014966.1 628-2405
2326-2328 L07597.1 2296-2298
2329-2680 BC014966.1 2409-2760
2681-2683 L07597.1 2645-2647
2684-3108 BC014966.1 2764-3188
3109-3112 AK092955.1 3198-3201
FEATURES Location/Qualifiers
source 1..3112
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p"
gene 1..3112
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="ribosomal protein S6 kinase, 90kDa, polypeptide 1"
/db_xref="GeneID:6195"
/db_xref="HGNC:10430"
/db_xref="MIM:601684"
exon 1..184
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 4
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:71640330"
variation 5
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201434625"
variation 39..40
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace=""
/replace="c"
/db_xref="dbSNP:35840157"
CDS 50..2284
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/EC_number="2.7.11.1"
/note="isoform b is encoded by transcript variant 2;
ribosomal protein S6 kinase alpha 1; p90-RSK 1; ribosomal
protein S6 kinase alpha-1; S6K-alpha 1; dJ590P13.1
(ribosomal protein S6 kinase, 90kD, polypeptide 1); RSK-1;
p90S6K; p90RSK1; MAPKAPK-1a; S6K-alpha-1; MAPKAP kinase
1a; ribosomal S6 kinase 1; MAPK-activated protein kinase
1a; 90 kDa ribosomal protein S6 kinase 1; MAP
kinase-activated protein kinase 1a"
/codon_start=1
/product="ribosomal protein S6 kinase alpha-1 isoform b"
/protein_id="NP_001006666.1"
/db_xref="GI:55743134"
/db_xref="CCDS:CCDS30649.1"
/db_xref="GeneID:6195"
/db_xref="HGNC:10430"
/db_xref="MIM:601684"
/translation="
MEQDPKPPRLRLWALIPWLPRKQRPRISQTSLPVPGPGSGPQRDSDEGVLKEISITHHVKAGSEKADPSHFELLKVLGQGSFGKVFLVRKVTRPDSGHLYAMKVLKKATLKVRDRVRTKMERDILADVNHPFVVKLHYAFQTEGKLYLILDFLRGGDLFTRLSKEVMFTEEDVKFYLAELALGLDHLHSLGIIYRDLKPENILLDEEGHIKLTDFGLSKEAIDHEKKAYSFCGTVEYMAPEVVNRQGHSHSADWWSYGVLMFEMLTGSLPFQGKDRKETMTLILKAKLGMPQFLSTEAQSLLRALFKRNPANRLGSGPDGAEEIKRHVFYSTIDWNKLYRREIKPPFKPAVAQPDDTFYFDTEFTSRTPKDSPGIPPSAGAHQLFRGFSFVATGLMEDDGKPRAPQAPLHSVVQQLHGKNLVFSDGYVVKETIGVGSYSECKRCVHKATNMEYAVKVIDKSKRDPSEEIEILLRYGQHPNIITLKDVYDDGKHVYLVTELMRGGELLDKILRQKFFSEREASFVLHTIGKTVEYLHSQGVVHRDLKPSNILYVDESGNPECLRICDFGFAKQLRAENGLLMTPCYTANFVAPEVLKRQGYDEGCDIWSLGILLYTMLAGYTPFANGPSDTPEEILTRIGSGKFTLSGGNWNTVSETAKDLVSKMLHVDPHQRLTAKQVLQHPWVTQKDKLPQSQLSHQDLQLVKGAMAATYSALNSSKPTPQLKPIESSILAQRRVRKLPSTTL
"
misc_feature 260..1036
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature 269..1222
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="N-terminal catalytic domain of the Protein
Serine/Threonine Kinase, 90 kDa ribosomal protein S6
kinase; Region: STKc_RSK_N; cd05582"
/db_xref="CDD:173673"
misc_feature order(278..292,302..304,350..352,356..358,449..451,
497..502,506..508,518..520,524..526,635..637,641..643,
647..652,656..658,686..691,698..700,740..757,836..838,
854..856,863..865)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="active site"
/db_xref="CDD:173673"
misc_feature order(278..292,302..304,350..352,356..358,449..451,
500..508,518..520,635..637,641..643,647..652,656..658,
686..691)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173673"
misc_feature order(290..292,518..520,524..526,635..637,641..643,
647..649,698..700,740..757,836..838,854..856,863..865)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173673"
misc_feature 536..538
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature order(686..721,725..757)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173673"
misc_feature 737..739
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05556"
misc_feature 749..751
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03402"
misc_feature 749..751
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1151..1153
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01496"
misc_feature 1163..1165
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="turn motif phosphorylation site [posttranslational
modification]; other site"
/db_xref="CDD:173673"
misc_feature 1163..1165
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01496"
misc_feature 1202..1219
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="hydrophobic motif (HM); other site"
/db_xref="CDD:173673"
misc_feature 1214..1216
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03402"
misc_feature 1328..2101
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="Serine/Threonine protein kinases, catalytic domain;
Region: S_TKc; smart00220"
/db_xref="CDD:197582"
misc_feature 1346..2098
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="Protein Kinases, catalytic domain; Region:
PKc_like; cl09925"
/db_xref="CDD:213116"
misc_feature order(1346..1360,1370..1372,1409..1411,1415..1417,
1493..1495,1541..1552,1562..1564,1568..1570,1679..1681,
1685..1687,1691..1696,1700..1702,1745..1747,1754..1756,
1802..1813)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="active site"
/db_xref="CDD:173623"
misc_feature order(1346..1360,1370..1372,1409..1411,1415..1417,
1493..1495,1541..1552,1562..1564,1679..1681,1685..1687,
1691..1696,1700..1702,1745..1747)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173623"
misc_feature order(1358..1360,1562..1564,1568..1570,1679..1681,
1685..1687,1691..1693,1754..1756,1802..1813)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173623"
misc_feature order(1742..1762,1802..1813)
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173623"
misc_feature 1793..1795
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1805..1807
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03402"
misc_feature 1805..1807
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2270..2272
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
variation 74
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:149509119"
variation 79
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377047340"
variation 80
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371482353"
variation 90
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:148249059"
variation 110
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201699710"
variation 163
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377611375"
variation 169
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace=""
/replace="c"
/db_xref="dbSNP:67503835"
exon 185..301
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 208
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202208797"
variation 212
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113539136"
variation 223
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200512418"
variation 224
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139078872"
variation 262
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371635262"
variation 268
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370115968"
variation 301
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace=""
/replace="a"
/db_xref="dbSNP:60319813"
exon 302..383
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 322
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:12028491"
variation 325
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201385156"
variation 346
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="g"
/replace="t"
/db_xref="dbSNP:150535662"
variation 376
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149695725"
exon 384..464
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 387
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373103051"
variation 436
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="g"
/replace="t"
/db_xref="dbSNP:2229710"
variation 460
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376032218"
exon 465..544
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 520
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371581310"
variation 530
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375857541"
exon 545..651
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 556
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="g"
/replace="t"
/db_xref="dbSNP:376383316"
variation 571
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372793504"
variation 583
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4970490"
variation 592
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199789905"
exon 652..689
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
exon 690..832
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 721
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141051128"
variation 738
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:873152"
variation 745
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:147965368"
variation 751
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:367795872"
variation 776
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141533618"
variation 787
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace=""
/replace="g"
/db_xref="dbSNP:67370581"
exon 833..903
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 847
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:375217524"
variation 868
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369496197"
variation 893
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:181351346"
exon 904..992
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 942
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138247663"
exon 993..1057
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1002
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace=""
/replace="c"
/db_xref="dbSNP:66696971"
exon 1058..1160
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1080
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2229712"
variation 1083
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201565442"
variation 1087
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11546001"
variation 1109
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:200823090"
variation 1136
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:370536932"
variation 1148
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:138571702"
variation 1149
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201153306"
variation 1151
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372835609"
exon 1161..1291
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1165
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143984856"
variation 1178
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138168136"
variation 1179
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:374505864"
variation 1206
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150753331"
variation 1209
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373109074"
variation 1229
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140901694"
variation 1243
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371215242"
variation 1246
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375770745"
variation 1263
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201413022"
variation 1271
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:200693344"
variation 1282
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150063775"
exon 1292..1417
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1324
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:149144046"
variation 1330
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:56018615"
variation 1331
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373923998"
variation 1351
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375786399"
exon 1418..1507
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1439
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:146829384"
variation 1469
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:372558260"
variation 1474
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1064196"
exon 1508..1666
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1528
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:112552710"
variation 1548
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="t"
/db_xref="dbSNP:369431738"
variation 1580
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:138370781"
variation 1604
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144489369"
variation 1609
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143525775"
variation 1610
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199860173"
variation 1632
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202075423"
variation 1663
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369922928"
exon 1667..1828
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1693
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373074678"
variation 1702
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200312178"
variation 1717
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11546000"
variation 1726
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374126540"
variation 1735
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:116009402"
variation 1822
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377161355"
variation 1825
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202239545"
exon 1829..1905
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1852
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:146788594"
variation 1882
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="g"
/replace="t"
/db_xref="dbSNP:143490841"
exon 1906..2023
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 1909
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374581897"
variation 1913
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377725709"
variation 1924
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371025431"
variation 1931
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368086441"
variation 1937
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:112905695"
variation 1959
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149093867"
variation 1960
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140088113"
variation 1961
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201508654"
variation 1964
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:369721857"
exon 2024..2161
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 2047
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:80024567"
variation 2055
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:368282746"
variation 2084
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:7417142"
variation 2125
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:145893180"
exon 2162..3112
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/inference="alignment:Splign:1.39.8"
variation 2178
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367842246"
variation 2179
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201125214"
variation 2185
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144389719"
variation 2212
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:2229713"
variation 2290
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:181744837"
variation 2299
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145772599"
variation 2300
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229714"
variation 2327
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="g"
/db_xref="dbSNP:282179"
variation 2331
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:151125319"
variation 2358
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141078619"
variation 2397
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:12121702"
STS 2422..3102
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/standard_name="RPS6KA1_8600"
/db_xref="UniSTS:468658"
variation 2467
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="g"
/replace="t"
/db_xref="dbSNP:111709494"
variation 2474
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372547001"
variation 2490
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377553777"
variation 2512
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="t"
/db_xref="dbSNP:12118436"
variation 2593
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371766931"
variation 2599
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:41303623"
variation 2609
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:114390260"
variation 2615
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:137855096"
variation 2677
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="c"
/db_xref="dbSNP:186868052"
variation 2682
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:11113"
variation 2693
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:14071"
STS 2756..3086
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/standard_name="SHGC-74446"
/db_xref="UniSTS:81238"
STS 2774..2902
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/standard_name="G34845"
/db_xref="UniSTS:18551"
variation 2781
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:41303625"
variation 2801
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:117144131"
variation 2849
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1804418"
STS 2861..3010
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/standard_name="RH70250"
/db_xref="UniSTS:78250"
variation 2911
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:7726"
variation 3012
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="a"
/replace="g"
/db_xref="dbSNP:192064574"
variation 3013
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376910879"
polyA_signal 3090..3095
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
polyA_site 3108
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
/experiment="experimental evidence, no additional details
recorded"
polyA_site 3112
/gene="RPS6KA1"
/gene_synonym="HU-1; MAPKAPK1A; RSK; RSK1"
ORIGIN
ccccggactctgcctgctcctgccatggtgccgtggccctgctgggcggatggagcaggatcccaagccgccccgtctgcggctctgggccctgatcccctggcttcccaggaagcagcggcccaggatcagccagacctctctgcctgtccctggccctggctctggcccccagcgggactcggatgagggcgtcctcaaggagatctccatcacgcaccacgtcaaggctggctctgagaaggctgatccatcccatttcgagctcctcaaggttctgggccagggatcctttggcaaagtcttcctggtgcggaaagtcacccggcctgacagtgggcacctgtatgctatgaaggtgctgaagaaggcaacgctgaaagtacgtgaccgcgtccggaccaagatggagagagacatcctggctgatgtaaatcacccattcgtggtgaagctgcactatgccttccagaccgagggcaagctctatctcattctggacttcctgcgtggtggggacctcttcacccggctctcaaaagaggtgatgttcacggaggaggatgtgaagttttacctggccgagctggctctgggcctggatcacctgcacagcctgggtatcatttacagagacctcaagcctgagaacatccttctggatgaggagggccacatcaaactcactgactttggcctgagcaaagaggccattgaccacgagaagaaggcctattctttctgcgggacagtggagtacatggcccctgaggtcgtcaaccgccagggccactcccatagtgcggactggtggtcctatggggtgttgatgtttgagatgctgacgggctccctgcccttccaggggaaggaccggaaggagaccatgacactgattctgaaggcgaagctaggcatgccccagtttctgagcactgaagcccagagcctcttgcgggccctgttcaagcggaatcctgccaaccggctcggctccggccctgatggggcagaggaaatcaagcggcatgtcttctactccaccattgactggaataagctataccgtcgtgagatcaagccacccttcaagccagcagtggctcagcctgatgacaccttctactttgacaccgagttcacgtcccgcacacccaaggattccccaggcatcccccccagcgctggggcccatcagctgttccggggcttcagcttcgtggccaccggcctgatggaagacgacggcaagcctcgtgccccgcaggcacccctgcactcggtggtacagcaactccatgggaagaacctggtttttagtgacggctacgtggtaaaggagacaattggtgtgggctcctactctgagtgcaagcgctgtgtccacaaggccaccaacatggagtatgctgtcaaggtcattgataagagcaagcgggatccttcagaagagattgagattcttctgcggtatggccagcaccccaacatcatcactctgaaagatgtgtatgatgatggcaaacacgtgtacctggtgacagagctgatgcggggtggggagctgctggacaagatcctgcggcagaagttcttctcagagcgggaggccagctttgtcctgcacaccattggcaaaactgtggagtatctgcactcacagggggttgtgcacagggacctgaagcccagcaacatcctgtatgtggacgagtccgggaatcccgagtgcctgcgcatctgtgactttggttttgccaaacagctgcgggctgagaatgggctcctcatgacaccttgctacacagccaactttgtggcgcctgaggtgctgaagcgccagggctacgatgaaggctgcgacatctggagcctgggcattctgctgtacaccatgctggcaggatatactccatttgccaacggtcccagtgacacaccagaggaaatcctaacccggatcggcagtgggaagtttaccctcagtgggggaaattggaacacagtttcagagacagccaaggacctggtgtccaagatgctacacgtggatccccaccagcgcctcacagctaagcaggttctgcagcatccatgggtcacccagaaagacaagcttccccaaagccagctgtcccaccaggacctacagcttgtgaagggagccatggctgccacgtactccgcactcaacagctccaagcccaccccccagctgaagcccatcgagtcatccatcctggcccagcggcgagtgaggaagttgccatccaccaccctgtgaggcaccagggcattcgggccacagggcggtgctagcttgacacagtcagcatgcttcccagagggagcaggccggaaccacagggccagagggagctggaacccgaggggccggggaagctgccagcccagaacacccctaatgagggtgtgagaagtgccttctccttccccaggatggactcttctcggctcaggctctgctggtggaaagcgattcactgtataaacttttttttatgaaaaaaatggcatcaaccaccatggatttttacaagatccatttgcctttctgggagcagaaacagccattgcggccccaggaggggaactgagtcacgctggggctctctgagactctttagagcagctttgggatcccaccctggggacccccacgattggccacctgtagccatctgcacacacctccgagacagtccagtgtcacctctctcagagcatctggctgtttagcagaactcattctatccccaatcagctccttttccgttctgttctgctgggagttctagaaccacttcctgctacaggaggggtctcatgtcctgctggcttccagcttcaggcaccagcatccaccttggctctgccagtggatcccctgcggtcaggctgggcagccccagagagaggatgtggaaagcactttttggctgacttcatctggggttggcaacaggacagagttcacaggaggccagtgggcgggccatgagggacagggtcttttttcatttcttcctcagctggttactcagggttcatctgtccatggcctttctaataaactgttgagttgaagcac
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6195 -> Molecular function: GO:0000287 [magnesium ion binding] evidence: IEA
GeneID:6195 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:6195 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6195 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:6195 -> Molecular function: GO:0043027 [cysteine-type endopeptidase inhibitor activity involved in apoptotic process] evidence: IDA
GeneID:6195 -> Biological process: GO:0002224 [toll-like receptor signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0002755 [MyD88-dependent toll-like receptor signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0002756 [MyD88-independent toll-like receptor signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:6195 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
GeneID:6195 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
GeneID:6195 -> Biological process: GO:0007411 [axon guidance] evidence: TAS
GeneID:6195 -> Biological process: GO:0030307 [positive regulation of cell growth] evidence: TAS
GeneID:6195 -> Biological process: GO:0034134 [toll-like receptor 2 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0034138 [toll-like receptor 3 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0034142 [toll-like receptor 4 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0034146 [toll-like receptor 5 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0034162 [toll-like receptor 9 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0034166 [toll-like receptor 10 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0035666 [TRIF-dependent toll-like receptor signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0038123 [toll-like receptor TLR1:TLR2 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0038124 [toll-like receptor TLR6:TLR2 signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: IMP
GeneID:6195 -> Biological process: GO:0043154 [negative regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IDA
GeneID:6195 -> Biological process: GO:0043555 [regulation of translation in response to stress] evidence: TAS
GeneID:6195 -> Biological process: GO:0043620 [regulation of DNA-dependent transcription in response to stress] evidence: TAS
GeneID:6195 -> Biological process: GO:0045087 [innate immune response] evidence: TAS
GeneID:6195 -> Biological process: GO:0045597 [positive regulation of cell differentiation] evidence: TAS
GeneID:6195 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IMP
GeneID:6195 -> Biological process: GO:0048011 [neurotrophin TRK receptor signaling pathway] evidence: TAS
GeneID:6195 -> Biological process: GO:0051403 [stress-activated MAPK cascade] evidence: TAS
GeneID:6195 -> Biological process: GO:2000491 [positive regulation of hepatic stellate cell activation] evidence: IMP
GeneID:6195 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:6195 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:6195 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:6195 -> Cellular component: GO:0005819 [spindle] evidence: IEA
GeneID:6195 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001006666 -> EC 2.7.11.1
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.