2024-03-29 00:02:35, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001001877 1038 bp mRNA linear PRI 17-MAR-2013 DEFINITION Homo sapiens heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 2, mRNA. ACCESSION NM_001001877 VERSION NM_001001877.1 GI:50312658 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1038) AUTHORS Shinka,T., Sato,Y., Chen,G., Naroda,T., Kinoshita,K., Unemi,Y., Tsuji,K., Toida,K., Iwamoto,T. and Nakahori,Y. TITLE Molecular characterization of heat shock-like factor encoded on the human Y chromosome, and implications for male infertility JOURNAL Biol. Reprod. 71 (1), 297-306 (2004) PUBMED 15044259 REFERENCE 2 (bases 1 to 1038) AUTHORS Tessari,A., Salata,E., Ferlin,A., Bartoloni,L., Slongo,M.L. and Foresta,C. TITLE Characterization of HSFY, a novel AZFb gene on the Y chromosome with a possible role in human spermatogenesis JOURNAL Mol. Hum. Reprod. 10 (4), 253-258 (2004) PUBMED 14985478 REMARK GeneRIF: Could have an important role in human spermatogenesis. REFERENCE 3 (bases 1 to 1038) AUTHORS Skaletsky,H., Kuroda-Kawaguchi,T., Minx,P.J., Cordum,H.S., Hillier,L., Brown,L.G., Repping,S., Pyntikova,T., Ali,J., Bieri,T., Chinwalla,A., Delehaunty,A., Delehaunty,K., Du,H., Fewell,G., Fulton,L., Fulton,R., Graves,T., Hou,S.F., Latrielle,P., Leonard,S., Mardis,E., Maupin,R., McPherson,J., Miner,T., Nash,W., Nguyen,C., Ozersky,P., Pepin,K., Rock,S., Rohlfing,T., Scott,K., Schultz,B., Strong,C., Tin-Wollam,A., Yang,S.P., Waterston,R.H., Wilson,R.K., Rozen,S. and Page,D.C. TITLE The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes JOURNAL Nature 423 (6942), 825-837 (2003) PUBMED 12815422 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC007379.2. Summary: This gene encodes a member of the heat shock factor (HSF) family of transcriptional activators for heat shock proteins. This gene is a candidate gene for azoospermia, since it localizes to a region of chromosome Y that is sometimes deleted in infertile males. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) includes a different exon in the 3' coding region, resulting in a frameshift and earlier termination codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. Isoform 2 lacks the HFS-type DNA-binding domain found in isoform 1. COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-610 AC007379.2 104010-104619 c 611-1038 AC007379.2 62344-62771 c FEATURES Location/Qualifiers source 1..1038 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Y" /map="Yq11.222" gene 1..1038 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="heat shock transcription factor, Y linked 2" /db_xref="GeneID:159119" /db_xref="HGNC:23950" /db_xref="HPRD:13680" exon 1..610 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /inference="alignment:Splign:1.39.8" misc_feature 74..76 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="upstream in-frame stop codon" CDS 98..709 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="isoform 2 is encoded by transcript variant 2; heat shock transcription factor, Y-linked; heat shock transcription factor 2-like protein" /codon_start=1 /product="heat shock transcription factor, Y-linked isoform 2" /protein_id="NP_001001877.1" /db_xref="GI:50312659" /db_xref="CCDS:CCDS35476.1" /db_xref="GeneID:159119" /db_xref="HGNC:23950" /db_xref="HPRD:13680" /translation="
MAHVSSETQDVSPKDELTASEASTRSPLCEHTFPGDSDLRSMIEEHAFQVLSQGSLLESPSYTVCVSEPDKDDDFLSLNFPRKLWKIVESDQFKSISWDENGTCIVINEELFKKEILETKAPYRIFQTDAIKSFVRQLNLYGFSKIQQNFQRSAFLATFLSEEKESSVLSKIRFTKMKLSRSSTYENRYLCCNLHLKDESNYS
" misc_feature 335..>562 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /note="HSF-type DNA-binding; Region: HSF_DNA-bind; pfam00447" /db_xref="CDD:201233" exon 611..1038 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /inference="alignment:Splign:1.39.8" variation complement(887) /gene="HSFY2" /gene_synonym="HSF2L; HSFY" /replace="c" /replace="t" /db_xref="dbSNP:112915209" polyA_site 1038 /gene="HSFY2" /gene_synonym="HSF2L; HSFY" ORIGIN
taagtgtacatgcttaggccttctgaagcagcatttgaagctgcagtcctgaaaaccatgcaggccggaagagtagataaagaaatatttatttgagatggcacatgtttcttcagaaactcaagatgtttcccccaaagatgaattaactgcttcagaagcctccactaggtctccattgtgtgaacacaccttccctggggactcagacttacggtcaatgattgaagaacatgcttttcaggttttgtcacaaggatccttgttagaaagtccaagttacacagtttgtgtctctgagccagataaagatgatgattttctttctctgaactttcccaggaaactttggaaaatagtggaaagtgaccaattcaagtctatttcatgggatgagaatggaacttgcatagtgattaatgaagaactcttcaagaaagaaattttggaaacaaaggctccttacagaatatttcaaactgatgctatcaaaagttttgttcgacagctcaacctttatggatttagtaaaattcaacagaattttcaaagatctgcctttctagccacctttctgtcagaagagaaagaatcgtctgtcttaagcaagatacgcttcaccaaaatgaaactttccagatcttcaacttatgaaaacaggtatttatgttgcaacttacatttaaaagatgagtcgaattactcataatccttagaagttagcttgtccgcatctgaaaattcacttttaccttgaagttcaatctgtctctgggaaagactagattggaagaataaaattcaagaatgtgatgttttagtaatggaaaagccaagagcgtcaggtggcaaaagtccttctgttactcaagaaaatgctctgaaaaattccttttctcttttttttttgtaaagattaactccacctcaccaccacaatgaggtatttttctcagcaattgacacctgtttactcagttactccctgtaactatgttatgctgtgaagtaggcaatacagttgttaaagaagaataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:159119 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:159119 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:159119 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:159119 -> Cellular component: GO:0005634 [nucleus] evidence: IEA GeneID:159119 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.