GGRNA Home | Help | Advanced search

2024-04-25 13:31:16, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_000326               1752 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens retinaldehyde binding protein 1 (RLBP1), mRNA.
ACCESSION   NM_000326
VERSION     NM_000326.4  GI:155029561
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1752)
  AUTHORS   Nojima,K., Hosono,K., Zhao,Y., Toshiba,T., Hikoya,A., Asai,T.,
            Kato,M., Kondo,M., Minoshima,S. and Hotta,Y.
  TITLE     Clinical features of a Japanese case with Bothnia dystrophy
  JOURNAL   Ophthalmic Genet. 33 (2), 83-88 (2012)
   PUBMED   22171637
  REMARK    GeneRIF: The clinical characteristics of a Japanese patient with a
            homozygous R234W mutation in RLBP1 are very similar to that of
            Swedish patients with Bothnia dystrophy.
REFERENCE   2  (bases 1 to 1752)
  AUTHORS   He,X., Lobsiger,J. and Stocker,A.
  TITLE     Molecular clues to Bothnia-type retinal dystrophy
  JOURNAL   Adv. Exp. Med. Biol. 723, 589-594 (2012)
   PUBMED   22183382
  REMARK    GeneRIF: The R234W mutation reveals impaired 11-cis-retinal release
            through stabilization of the ligand complex.
REFERENCE   3  (bases 1 to 1752)
  AUTHORS   Neutzner,R.V., Jager,M., Friedburg,C., Deeg,C.A. and Lorenz,B.
  TITLE     [Blind spot enlargement syndrome in acute zonal occult outer
            retinopathy with detection of autoantibodies against the retinal
            antigens CRALBP and S-Ag]
  JOURNAL   Ophthalmologe 108 (11), 1045-1049 (2011)
   PUBMED   21904838
  REMARK    GeneRIF: Identification of autoantibodies specific for two retinal
            antigens (CRALBP and S-Ag) supports the concept of an
            autoimmunological origin of the disease.
REFERENCE   4  (bases 1 to 1752)
  AUTHORS   Naz,S., Ali,S., Riazuddin,S.A., Farooq,T., Butt,N.H., Zafar,A.U.,
            Khan,S.N., Husnain,T., Macdonald,I.M., Sieving,P.A.,
            Hejtmancik,J.F. and Riazuddin,S.
  TITLE     Mutations in RLBP1 associated with fundus albipunctatus in
            consanguineous Pakistani families
  JOURNAL   Br J Ophthalmol 95 (7), 1019-1024 (2011)
   PUBMED   21447491
  REMARK    GeneRIF: mutations in RLBP1 are responsible for fundus
            albipunctatus in the affected individuals of these consanguineous
            Pakistani families.
REFERENCE   5  (bases 1 to 1752)
  AUTHORS   Booij,J.C., Bakker,A., Kulumbetova,J., Moutaoukil,Y., Smeets,B.,
            Verheij,J., Kroes,H.Y., Klaver,C.C., van Schooneveld,M.,
            Bergen,A.A. and Florijn,R.J.
  TITLE     Simultaneous mutation detection in 90 retinal disease genes in
            multiple patients using a custom-designed 300-kb retinal
            resequencing chip
  JOURNAL   Ophthalmology 118 (1), 160-167 (2011)
   PUBMED   20801516
  REMARK    GeneRIF: Observational study of genetic testing. (HuGE Navigator)
REFERENCE   6  (bases 1 to 1752)
  AUTHORS   Sarthy,V.
  TITLE     Cellular retinaldehyde-binding protein localization in cornea
  JOURNAL   Exp. Eye Res. 63 (6), 759-762 (1996)
   PUBMED   9068383
REFERENCE   7  (bases 1 to 1752)
  AUTHORS   Dunn,K.C., Aotaki-Keen,A.E., Putkey,F.R. and Hjelmeland,L.M.
  TITLE     ARPE-19, a human retinal pigment epithelial cell line with
            differentiated properties
  JOURNAL   Exp. Eye Res. 62 (2), 155-169 (1996)
   PUBMED   8698076
REFERENCE   8  (bases 1 to 1752)
  AUTHORS   Intres,R., Goldflam,S., Cook,J.R. and Crabb,J.W.
  TITLE     Molecular cloning and structural analysis of the human gene
            encoding cellular retinaldehyde-binding protein
  JOURNAL   J. Biol. Chem. 269 (41), 25411-25418 (1994)
   PUBMED   7929238
REFERENCE   9  (bases 1 to 1752)
  AUTHORS   Sparkes,R.S., Heinzmann,C., Goldflam,S., Kojis,T., Saari,J.C.,
            Mohandas,T., Klisak,I., Bateman,J.B. and Crabb,J.W.
  TITLE     Assignment of the gene (RLBP1) for cellular retinaldehyde-binding
            protein (CRALBP) to human chromosome 15q26 and mouse chromosome 7
  JOURNAL   Genomics 12 (1), 58-62 (1992)
   PUBMED   1733864
REFERENCE   10 (bases 1 to 1752)
  AUTHORS   Crabb,J.W., Goldflam,S., Harris,S.E. and Saari,J.C.
  TITLE     Cloning of the cDNAs encoding the cellular retinaldehyde-binding
            protein from bovine and human retina and comparison of the protein
            structures
  JOURNAL   J. Biol. Chem. 263 (35), 18688-18692 (1988)
   PUBMED   3198595
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC124068.6.
            This sequence is a reference standard in the RefSeqGene project.
            On Aug 10, 2007 this sequence version replaced gi:38201694.
            
            Summary: The protein encoded by this gene is a 36-kD water-soluble
            protein which carries 11-cis-retinaldehyde or 11-cis-retinal as
            physiologic ligands. It may be a functional component of the visual
            cycle. Mutations of this gene have been associated with severe
            rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal
            recessive retinitis pigmentosa) and retinitis punctata albescens.
            [provided by RefSeq, Jul 2008].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC004199.2, AK312457.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025082, ERS025084 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-157               AC124068.6         55114-55270         c
            158-280             AC124068.6         53316-53438         c
            281-392             AC124068.6         52543-52654         c
            393-521             AC124068.6         52144-52272         c
            522-726             AC124068.6         50699-50903         c
            727-905             AC124068.6         48639-48817         c
            906-1064            AC124068.6         45322-45480         c
            1065-1175           AC124068.6         44278-44388         c
            1176-1752           AC124068.6         43446-44022         c
FEATURES             Location/Qualifiers
     source          1..1752
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q26"
     gene            1..1752
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="retinaldehyde binding protein 1"
                     /db_xref="GeneID:6017"
                     /db_xref="HGNC:10024"
                     /db_xref="HPRD:01572"
                     /db_xref="MIM:180090"
     exon            1..157
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     exon            158..280
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     exon            281..392
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    297..299
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="upstream in-frame stop codon"
     variation       311
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3743384"
     CDS             381..1334
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="cellular retinaldehyde-binding protein-1"
                     /codon_start=1
                     /product="retinaldehyde-binding protein 1"
                     /protein_id="NP_000317.1"
                     /db_xref="GI:4506541"
                     /db_xref="CCDS:CCDS32324.1"
                     /db_xref="GeneID:6017"
                     /db_xref="HGNC:10024"
                     /db_xref="HPRD:01572"
                     /db_xref="MIM:180090"
                     /translation="
MSEGVGTFRMVPEEEQELRAQLEQLTTKDHGPVFGPCSQLPRHTLQKAKDELNEREETREEAVRELQEMVQAQAASGEELAVAVAERVQEKDSGFFLRFIRARKFNVGRAYELLRGYVNFRLQYPELFDSLSPEAVRCTIEAGYPGVLSSRDKYGRVVMLFNIENWQSQEITFDEILQAYCFILEKLLENEETQINGFCIIENFKGFTMQQAASLRTSDLRKMVDMLQDSFPARFKAIHFIHQPWYFTTTYNVVKPFLKSKLLERVFVHGDDLSGFYQEIDENILPSDFGGTLPKYDGKAVAEQLFGPQAQAENTAF
"
     misc_feature    612..731
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="CRAL/TRIO, N-terminal domain; Region: CRAL_TRIO_N;
                     smart01100"
                     /db_xref="CDD:198168"
     misc_feature    801..1256
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="Sec14p-like lipid-binding domain. Found in
                     secretory proteins, such as S. cerevisiae
                     phosphatidylinositol transfer protein (Sec14p), and in
                     lipid regulated proteins such as RhoGAPs, RhoGEFs and
                     neurofibromin (NF1). SEC14 domain of Dbl is known to...;
                     Region: SEC14; cd00170"
                     /db_xref="CDD:29115"
     misc_feature    order(849..851,855..857,861..863,939..941,984..986,
                     990..992,1038..1040,1050..1052,1062..1064,1074..1076,
                     1083..1085,1092..1094,1098..1100,1119..1121,1140..1142,
                     1176..1178)
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="phospholipid binding pocket [chemical binding];
                     other site"
                     /db_xref="CDD:29115"
     misc_feature    order(1077..1079,1173..1175)
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /note="salt bridge; other site"
                     /db_xref="CDD:29115"
     exon            393..521
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     STS             440..564
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /standard_name="GDB:453389"
                     /db_xref="UniSTS:157413"
     exon            522..726
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     exon            727..905
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     exon            906..1064
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     exon            1065..1175
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     exon            1176..1752
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /inference="alignment:Splign:1.39.8"
     STS             1185..1351
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /standard_name="RH17590"
                     /db_xref="UniSTS:24820"
     STS             1375..1700
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /standard_name="WI-7222"
                     /db_xref="UniSTS:49023"
     variation       1501
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:834"
     variation       1630
                     /gene="RLBP1"
                     /gene_synonym="CRALBP"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2710"
ORIGIN      
gagcccgatttaacggaaactgtgggcggtgagaagttccttatgacacactaatcccaacctgctgaccggaccacgcctccagcggagggaacctctagagctccaggacattcaggtaccaggtagccccaaggaggagctgccgacctggcagggaacaaccaagactggggttaaatctcacagcctgcaagtggaagagaagaacttgaacccaggtccaacttttgcgccacagcaggctgcctcttggtcctgacaggaagtcacaacttggccctgacttcctatcctagggaaggggccggctggagaggccaggacagagaaagcagatcccttctttttccaaggactctgtgtcttccataggcaacatgtcagaaggggtgggcacgttccgcatggtacctgaagaggaacaggagctccgtgcccaactggagcagctcacaaccaaggaccatggacctgtctttggcccgtgcagccagctgccccgccacaccttgcagaaggccaaggatgagctgaacgagagagaggagacccgggaggaggcagtgcgagagctgcaggagatggtgcaggcgcaggcggcctcgggggaggagctggcggtggccgtggcggagagggtgcaagagaaggacagcggcttcttcctgcgcttcatccgcgcacggaagttcaacgtgggccgtgcctatgagctgctcagaggctatgtgaatttccggctgcagtaccctgagctctttgacagcctgtccccagaggctgtccgctgcaccattgaagctggctaccctggtgtcctctctagtcgggacaagtatggccgagtggtcatgctcttcaacattgagaactggcaaagtcaagaaatcacctttgatgagatcttgcaggcatattgcttcatcctggagaagctgctggagaatgaggaaactcaaatcaatggcttctgcatcattgagaacttcaagggctttaccatgcagcaggctgctagtctccggacttcagatctcaggaagatggtggacatgctccaggattccttcccagcccggttcaaagccatccacttcatccaccagccatggtacttcaccacgacctacaatgtggtcaagcccttcttgaagagcaagctgcttgagagggtctttgtccacggggatgacctttctggtttctaccaggagatcgatgagaacatcctgccctctgacttcgggggcacgctgcccaagtatgatggcaaggccgttgctgagcagctctttggcccccaggcccaagctgagaacacagccttctgaaaacatctcctgccagctgaactgtagttagaatctctgggcctctcctcaactgtcctggacccaaggctaggaaagggctgcttgagatgactgtggtccccccttagactccctaagcccgagtgagctcaggtgtcaccctgttctcaagttgggggatgggtaataaaggagggggaattcccttgaacaagaagaactggggatagttatatttccacctgcccttgaagctttaagacagtgatttttgtgtaaggttgtatttcaaagactcgaattcattttctcagtcatttcctttgtaacagagttttacgacttagagtctgtgaaaacaggcaaggagcccgggttaaaatatccccctattcgcccccaaaatgcaataaaagaagataaaagagagaggata
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6017 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA
            GeneID:6017 -> Molecular function: GO:0005502 [11-cis retinal binding] evidence: IEA
            GeneID:6017 -> Molecular function: GO:0019841 [retinol binding] evidence: IEA
            GeneID:6017 -> Biological process: GO:0001523 [retinoid metabolic process] evidence: TAS
            GeneID:6017 -> Biological process: GO:0006776 [vitamin A metabolic process] evidence: TAS
            GeneID:6017 -> Biological process: GO:0007601 [visual perception] evidence: IEA
            GeneID:6017 -> Biological process: GO:0007603 [phototransduction, visible light] evidence: TAS
            GeneID:6017 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
            GeneID:6017 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:6017 -> Cellular component: GO:0044297 [cell body] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.