2024-04-25 09:57:19, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000326 1752 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens retinaldehyde binding protein 1 (RLBP1), mRNA. ACCESSION NM_000326 VERSION NM_000326.4 GI:155029561 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1752) AUTHORS Nojima,K., Hosono,K., Zhao,Y., Toshiba,T., Hikoya,A., Asai,T., Kato,M., Kondo,M., Minoshima,S. and Hotta,Y. TITLE Clinical features of a Japanese case with Bothnia dystrophy JOURNAL Ophthalmic Genet. 33 (2), 83-88 (2012) PUBMED 22171637 REMARK GeneRIF: The clinical characteristics of a Japanese patient with a homozygous R234W mutation in RLBP1 are very similar to that of Swedish patients with Bothnia dystrophy. REFERENCE 2 (bases 1 to 1752) AUTHORS He,X., Lobsiger,J. and Stocker,A. TITLE Molecular clues to Bothnia-type retinal dystrophy JOURNAL Adv. Exp. Med. Biol. 723, 589-594 (2012) PUBMED 22183382 REMARK GeneRIF: The R234W mutation reveals impaired 11-cis-retinal release through stabilization of the ligand complex. REFERENCE 3 (bases 1 to 1752) AUTHORS Neutzner,R.V., Jager,M., Friedburg,C., Deeg,C.A. and Lorenz,B. TITLE [Blind spot enlargement syndrome in acute zonal occult outer retinopathy with detection of autoantibodies against the retinal antigens CRALBP and S-Ag] JOURNAL Ophthalmologe 108 (11), 1045-1049 (2011) PUBMED 21904838 REMARK GeneRIF: Identification of autoantibodies specific for two retinal antigens (CRALBP and S-Ag) supports the concept of an autoimmunological origin of the disease. REFERENCE 4 (bases 1 to 1752) AUTHORS Naz,S., Ali,S., Riazuddin,S.A., Farooq,T., Butt,N.H., Zafar,A.U., Khan,S.N., Husnain,T., Macdonald,I.M., Sieving,P.A., Hejtmancik,J.F. and Riazuddin,S. TITLE Mutations in RLBP1 associated with fundus albipunctatus in consanguineous Pakistani families JOURNAL Br J Ophthalmol 95 (7), 1019-1024 (2011) PUBMED 21447491 REMARK GeneRIF: mutations in RLBP1 are responsible for fundus albipunctatus in the affected individuals of these consanguineous Pakistani families. REFERENCE 5 (bases 1 to 1752) AUTHORS Booij,J.C., Bakker,A., Kulumbetova,J., Moutaoukil,Y., Smeets,B., Verheij,J., Kroes,H.Y., Klaver,C.C., van Schooneveld,M., Bergen,A.A. and Florijn,R.J. TITLE Simultaneous mutation detection in 90 retinal disease genes in multiple patients using a custom-designed 300-kb retinal resequencing chip JOURNAL Ophthalmology 118 (1), 160-167 (2011) PUBMED 20801516 REMARK GeneRIF: Observational study of genetic testing. (HuGE Navigator) REFERENCE 6 (bases 1 to 1752) AUTHORS Sarthy,V. TITLE Cellular retinaldehyde-binding protein localization in cornea JOURNAL Exp. Eye Res. 63 (6), 759-762 (1996) PUBMED 9068383 REFERENCE 7 (bases 1 to 1752) AUTHORS Dunn,K.C., Aotaki-Keen,A.E., Putkey,F.R. and Hjelmeland,L.M. TITLE ARPE-19, a human retinal pigment epithelial cell line with differentiated properties JOURNAL Exp. Eye Res. 62 (2), 155-169 (1996) PUBMED 8698076 REFERENCE 8 (bases 1 to 1752) AUTHORS Intres,R., Goldflam,S., Cook,J.R. and Crabb,J.W. TITLE Molecular cloning and structural analysis of the human gene encoding cellular retinaldehyde-binding protein JOURNAL J. Biol. Chem. 269 (41), 25411-25418 (1994) PUBMED 7929238 REFERENCE 9 (bases 1 to 1752) AUTHORS Sparkes,R.S., Heinzmann,C., Goldflam,S., Kojis,T., Saari,J.C., Mohandas,T., Klisak,I., Bateman,J.B. and Crabb,J.W. TITLE Assignment of the gene (RLBP1) for cellular retinaldehyde-binding protein (CRALBP) to human chromosome 15q26 and mouse chromosome 7 JOURNAL Genomics 12 (1), 58-62 (1992) PUBMED 1733864 REFERENCE 10 (bases 1 to 1752) AUTHORS Crabb,J.W., Goldflam,S., Harris,S.E. and Saari,J.C. TITLE Cloning of the cDNAs encoding the cellular retinaldehyde-binding protein from bovine and human retina and comparison of the protein structures JOURNAL J. Biol. Chem. 263 (35), 18688-18692 (1988) PUBMED 3198595 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC124068.6. This sequence is a reference standard in the RefSeqGene project. On Aug 10, 2007 this sequence version replaced gi:38201694. Summary: The protein encoded by this gene is a 36-kD water-soluble protein which carries 11-cis-retinaldehyde or 11-cis-retinal as physiologic ligands. It may be a functional component of the visual cycle. Mutations of this gene have been associated with severe rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal recessive retinitis pigmentosa) and retinitis punctata albescens. [provided by RefSeq, Jul 2008]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC004199.2, AK312457.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025082, ERS025084 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-157 AC124068.6 55114-55270 c 158-280 AC124068.6 53316-53438 c 281-392 AC124068.6 52543-52654 c 393-521 AC124068.6 52144-52272 c 522-726 AC124068.6 50699-50903 c 727-905 AC124068.6 48639-48817 c 906-1064 AC124068.6 45322-45480 c 1065-1175 AC124068.6 44278-44388 c 1176-1752 AC124068.6 43446-44022 c FEATURES Location/Qualifiers source 1..1752 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="15" /map="15q26" gene 1..1752 /gene="RLBP1" /gene_synonym="CRALBP" /note="retinaldehyde binding protein 1" /db_xref="GeneID:6017" /db_xref="HGNC:10024" /db_xref="HPRD:01572" /db_xref="MIM:180090" exon 1..157 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" exon 158..280 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" exon 281..392 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" misc_feature 297..299 /gene="RLBP1" /gene_synonym="CRALBP" /note="upstream in-frame stop codon" variation 311 /gene="RLBP1" /gene_synonym="CRALBP" /replace="a" /replace="g" /db_xref="dbSNP:3743384" CDS 381..1334 /gene="RLBP1" /gene_synonym="CRALBP" /note="cellular retinaldehyde-binding protein-1" /codon_start=1 /product="retinaldehyde-binding protein 1" /protein_id="NP_000317.1" /db_xref="GI:4506541" /db_xref="CCDS:CCDS32324.1" /db_xref="GeneID:6017" /db_xref="HGNC:10024" /db_xref="HPRD:01572" /db_xref="MIM:180090" /translation="
MSEGVGTFRMVPEEEQELRAQLEQLTTKDHGPVFGPCSQLPRHTLQKAKDELNEREETREEAVRELQEMVQAQAASGEELAVAVAERVQEKDSGFFLRFIRARKFNVGRAYELLRGYVNFRLQYPELFDSLSPEAVRCTIEAGYPGVLSSRDKYGRVVMLFNIENWQSQEITFDEILQAYCFILEKLLENEETQINGFCIIENFKGFTMQQAASLRTSDLRKMVDMLQDSFPARFKAIHFIHQPWYFTTTYNVVKPFLKSKLLERVFVHGDDLSGFYQEIDENILPSDFGGTLPKYDGKAVAEQLFGPQAQAENTAF
" misc_feature 612..731 /gene="RLBP1" /gene_synonym="CRALBP" /note="CRAL/TRIO, N-terminal domain; Region: CRAL_TRIO_N; smart01100" /db_xref="CDD:198168" misc_feature 801..1256 /gene="RLBP1" /gene_synonym="CRALBP" /note="Sec14p-like lipid-binding domain. Found in secretory proteins, such as S. cerevisiae phosphatidylinositol transfer protein (Sec14p), and in lipid regulated proteins such as RhoGAPs, RhoGEFs and neurofibromin (NF1). SEC14 domain of Dbl is known to...; Region: SEC14; cd00170" /db_xref="CDD:29115" misc_feature order(849..851,855..857,861..863,939..941,984..986, 990..992,1038..1040,1050..1052,1062..1064,1074..1076, 1083..1085,1092..1094,1098..1100,1119..1121,1140..1142, 1176..1178) /gene="RLBP1" /gene_synonym="CRALBP" /note="phospholipid binding pocket [chemical binding]; other site" /db_xref="CDD:29115" misc_feature order(1077..1079,1173..1175) /gene="RLBP1" /gene_synonym="CRALBP" /note="salt bridge; other site" /db_xref="CDD:29115" exon 393..521 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" STS 440..564 /gene="RLBP1" /gene_synonym="CRALBP" /standard_name="GDB:453389" /db_xref="UniSTS:157413" exon 522..726 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" exon 727..905 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" exon 906..1064 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" exon 1065..1175 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" exon 1176..1752 /gene="RLBP1" /gene_synonym="CRALBP" /inference="alignment:Splign:1.39.8" STS 1185..1351 /gene="RLBP1" /gene_synonym="CRALBP" /standard_name="RH17590" /db_xref="UniSTS:24820" STS 1375..1700 /gene="RLBP1" /gene_synonym="CRALBP" /standard_name="WI-7222" /db_xref="UniSTS:49023" variation 1501 /gene="RLBP1" /gene_synonym="CRALBP" /replace="g" /replace="t" /db_xref="dbSNP:834" variation 1630 /gene="RLBP1" /gene_synonym="CRALBP" /replace="a" /replace="g" /db_xref="dbSNP:2710" ORIGIN
gagcccgatttaacggaaactgtgggcggtgagaagttccttatgacacactaatcccaacctgctgaccggaccacgcctccagcggagggaacctctagagctccaggacattcaggtaccaggtagccccaaggaggagctgccgacctggcagggaacaaccaagactggggttaaatctcacagcctgcaagtggaagagaagaacttgaacccaggtccaacttttgcgccacagcaggctgcctcttggtcctgacaggaagtcacaacttggccctgacttcctatcctagggaaggggccggctggagaggccaggacagagaaagcagatcccttctttttccaaggactctgtgtcttccataggcaacatgtcagaaggggtgggcacgttccgcatggtacctgaagaggaacaggagctccgtgcccaactggagcagctcacaaccaaggaccatggacctgtctttggcccgtgcagccagctgccccgccacaccttgcagaaggccaaggatgagctgaacgagagagaggagacccgggaggaggcagtgcgagagctgcaggagatggtgcaggcgcaggcggcctcgggggaggagctggcggtggccgtggcggagagggtgcaagagaaggacagcggcttcttcctgcgcttcatccgcgcacggaagttcaacgtgggccgtgcctatgagctgctcagaggctatgtgaatttccggctgcagtaccctgagctctttgacagcctgtccccagaggctgtccgctgcaccattgaagctggctaccctggtgtcctctctagtcgggacaagtatggccgagtggtcatgctcttcaacattgagaactggcaaagtcaagaaatcacctttgatgagatcttgcaggcatattgcttcatcctggagaagctgctggagaatgaggaaactcaaatcaatggcttctgcatcattgagaacttcaagggctttaccatgcagcaggctgctagtctccggacttcagatctcaggaagatggtggacatgctccaggattccttcccagcccggttcaaagccatccacttcatccaccagccatggtacttcaccacgacctacaatgtggtcaagcccttcttgaagagcaagctgcttgagagggtctttgtccacggggatgacctttctggtttctaccaggagatcgatgagaacatcctgccctctgacttcgggggcacgctgcccaagtatgatggcaaggccgttgctgagcagctctttggcccccaggcccaagctgagaacacagccttctgaaaacatctcctgccagctgaactgtagttagaatctctgggcctctcctcaactgtcctggacccaaggctaggaaagggctgcttgagatgactgtggtccccccttagactccctaagcccgagtgagctcaggtgtcaccctgttctcaagttgggggatgggtaataaaggagggggaattcccttgaacaagaagaactggggatagttatatttccacctgcccttgaagctttaagacagtgatttttgtgtaaggttgtatttcaaagactcgaattcattttctcagtcatttcctttgtaacagagttttacgacttagagtctgtgaaaacaggcaaggagcccgggttaaaatatccccctattcgcccccaaaatgcaataaaagaagataaaagagagaggata
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:6017 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA GeneID:6017 -> Molecular function: GO:0005502 [11-cis retinal binding] evidence: IEA GeneID:6017 -> Molecular function: GO:0019841 [retinol binding] evidence: IEA GeneID:6017 -> Biological process: GO:0001523 [retinoid metabolic process] evidence: TAS GeneID:6017 -> Biological process: GO:0006776 [vitamin A metabolic process] evidence: TAS GeneID:6017 -> Biological process: GO:0007601 [visual perception] evidence: IEA GeneID:6017 -> Biological process: GO:0007603 [phototransduction, visible light] evidence: TAS GeneID:6017 -> Cellular component: GO:0005575 [cellular_component] evidence: ND GeneID:6017 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:6017 -> Cellular component: GO:0044297 [cell body] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.