Home |
Help |
Advanced search
2024-04-19 11:59:33, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000304 1828 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens peripheral myelin protein 22 (PMP22), transcript
variant 1, mRNA.
ACCESSION NM_000304
VERSION NM_000304.2 GI:24430161
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1828)
AUTHORS Chanson,J.B., Echaniz-Laguna,A., Blanc,F., Lacour,A.,
Ballonzoli,L., Kremer,S., Namer,I.J., Lannes,B., Tranchant,C.,
Vermersch,P. and de Seze,J.
TITLE Central nervous system abnormalities in patients with PMP22 gene
mutations: a prospective study
JOURNAL J. Neurol. Neurosurg. Psychiatr. 84 (4), 392-397 (2013)
PUBMED 23243264
REMARK GeneRIF: altered PMP22 gene expression induces significant central
nervous system alterations in patients with hereditary neuropathy
with liability to pressure palsies and Charcot-Marie-Tooth 1A
REFERENCE 2 (bases 1 to 1828)
AUTHORS Lu Y, Vitart V, Burdon KP, Khor CC, Bykhovskaya Y, Mirshahi A,
Hewitt AW, Koehn D, Hysi PG, Ramdas WD, Zeller T, Vithana EN,
Cornes BK, Tay WT, Tai ES, Cheng CY, Liu J, Foo JN, Saw SM,
Thorleifsson G, Stefansson K, Dimasi DP, Mills RA, Mountain J, Ang
W, Hoehn R, Verhoeven VJ, Grus F, Wolfs R, Castagne R, Lackner KJ,
Springelkamp H, Yang J, Jonasson F, Leung DY, Chen LJ, Tham CC,
Rudan I, Vatavuk Z, Hayward C, Gibson J, Cree AJ, MacLeod A, Ennis
S, Polasek O, Campbell H, Wilson JF, Viswanathan AC, Fleck B, Li X,
Siscovick D, Taylor KD, Rotter JI, Yazar S, Ulmer M, Li J, Yaspan
BL, Ozel AB, Richards JE, Moroi SE, Haines JL, Kang JH, Pasquale
LR, Allingham RR, Ashley-Koch A, Mitchell P, Wang JJ, Wright AF,
Pennell C, Spector TD, Young TL, Klaver CC, Martin NG, Montgomery
GW, Anderson MG, Aung T, Willoughby CE, Wiggs JL, Pang CP,
Thorsteinsdottir U, Lotery AJ, Hammond CJ, van Duijn CM, Hauser MA,
Rabinowitz YS, Pfeiffer N, Mackey DA, Craig JE, Macgregor S and
Wong TY.
CONSRTM NEIGHBOR Consortium
TITLE Genome-wide association analyses identify multiple loci associated
with central corneal thickness and keratoconus
JOURNAL Nat. Genet. 45 (2), 155-163 (2013)
PUBMED 23291589
REFERENCE 3 (bases 1 to 1828)
AUTHORS Taioli,F., Bertolasi,L., Ajena,D., Ferrarini,M., Cabrini,I.,
Crestanello,A. and Fabrizi,G.M.
TITLE Parental mosaicism of a novel PMP22 mutation with a minimal
neuropathic phenotype
JOURNAL J. Peripher. Nerv. Syst. 17 (4), 414-417 (2012)
PUBMED 23279344
REMARK GeneRIF: We describe a novel heterozygous p.Trp39Cys missense
mutation in the extracellular domain of the peripheral myelin
protein 22 (PMP22) associated with an early-onset demyelinating
Charcot-Marie-Tooth type 1 E
REFERENCE 4 (bases 1 to 1828)
AUTHORS Jones,E.A., Brewer,M.H., Srinivasan,R., Krueger,C., Sun,G.,
Charney,K.N., Keles,S., Antonellis,A. and Svaren,J.
TITLE Distal enhancers upstream of the Charcot-Marie-Tooth type 1A
disease gene PMP22
JOURNAL Hum. Mol. Genet. 21 (7), 1581-1591 (2012)
PUBMED 22180461
REMARK GeneRIF: A subset of EGR2 and SOX10 consensus sequences are
essential for enhancer activity of the PMP22 gene.
REFERENCE 5 (bases 1 to 1828)
AUTHORS Karadima,G., Floroskufi,P., Koutsis,G., Vassilopoulos,D. and
Panas,M.
TITLE Mutational analysis of PMP22, GJB1 and MPZ in Greek
Charcot-Marie-Tooth type 1 neuropathy patients
JOURNAL Clin. Genet. 80 (5), 497-499 (2011)
PUBMED 22243284
REMARK GeneRIF: our results suggest a low relative CMT1A duplication
frequency in the Greek population
REFERENCE 6 (bases 1 to 1828)
AUTHORS Takahashi,E., Takeda,O., Himoro,M., Nanao,K., Takada,G. and
Hayasaka,K.
TITLE Localization of PMP-22 gene (candidate gene for the
Charcot-Marie-Tooth disease 1A) to band 17p11.2 by direct R-banding
fluorescence in situ hybridization
JOURNAL Jpn. J. Hum. Genet. 37 (4), 303-306 (1992)
PUBMED 1297450
REFERENCE 7 (bases 1 to 1828)
AUTHORS Martinotti,A., Cariani,C.T., Melani,C., Sozzi,G., Spurr,N.K.,
Pierotti,M.A. and Colombo,M.P.
TITLE Isolation and mapping to 17p12-13 of the human homologous of the
murine growth arrest specific Gas-3 gene
JOURNAL Hum. Mol. Genet. 1 (5), 331-334 (1992)
PUBMED 1303210
REFERENCE 8 (bases 1 to 1828)
AUTHORS Valentijn,L.J., Bolhuis,P.A., Zorn,I., Hoogendijk,J.E., van den
Bosch,N., Hensels,G.W., Stanton,V.P. Jr., Housman,D.E.,
Fischbeck,K.H., Ross,D.A. et al.
TITLE The peripheral myelin gene PMP-22/GAS-3 is duplicated in
Charcot-Marie-Tooth disease type 1A
JOURNAL Nat. Genet. 1 (3), 166-170 (1992)
PUBMED 1303229
REFERENCE 9 (bases 1 to 1828)
AUTHORS Patel,P.I., Roa,B.B., Welcher,A.A., Schoener-Scott,R., Trask,B.J.,
Pentao,L., Snipes,G.J., Garcia,C.A., Francke,U., Shooter,E.M.,
Lupski,J.R. and Suter,U.
TITLE The gene for the peripheral myelin protein PMP-22 is a candidate
for Charcot-Marie-Tooth disease type 1A
JOURNAL Nat. Genet. 1 (3), 159-165 (1992)
PUBMED 1303228
REFERENCE 10 (bases 1 to 1828)
AUTHORS Lewis,D.O.
TITLE Diagnostic evaluation of the juvenile offender: toward the
clarification of often overlooked psychopathology
JOURNAL Child Psychiatry Hum Dev 6 (4), 198-213 (1976)
PUBMED 954484
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from D11428.1 and U08049.1.
This sequence is a reference standard in the RefSeqGene project.
On Oct 30, 2002 this sequence version replaced gi:4505906.
Summary: This gene encodes an integral membrane protein that is a
major component of myelin in the peripheral nervous system. Various
mutations of this gene are causes of Charcot-Marie-Tooth disease
Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with
liability to pressure palsies. Alternative splicing of this gene
results in three transcript variants that encode the same protein.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longest
transcript. Expression of this variant is predominant in neuronal
tissues during myelin formation in nerve development and
regeneration. Variants 1, 2, and 3 encode the same protein.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: D11428.1, BC091499.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088, ERS025098 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: full length.
FEATURES Location/Qualifiers
source 1..1828
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17p12"
gene 1..1828
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/note="peripheral myelin protein 22"
/db_xref="GeneID:5376"
/db_xref="HGNC:9118"
/db_xref="HPRD:03059"
/db_xref="MIM:601097"
exon 1..174
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="alignment:Splign:1.39.8"
exon 175..286
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="alignment:Splign:1.39.8"
misc_feature 188..190
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/note="upstream in-frame stop codon"
CDS 209..691
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/note="growth arrest-specific 3; PMP-22; growth
arrest-specific protein 3"
/codon_start=1
/product="peripheral myelin protein 22"
/protein_id="NP_000295.1"
/db_xref="GI:4505907"
/db_xref="CCDS:CCDS11168.1"
/db_xref="GeneID:5376"
/db_xref="HGNC:9118"
/db_xref="HPRD:03059"
/db_xref="MIM:601097"
/translation="
MLLLLLSIIVLHVAVLVLLFVSTIVSQWIVGNGHATDLWQNCSTSSSGNVHHCFSSSPNEWLQSVQATMILSIIFSILSLFLFFCQLFTLTKGGRFYITGIFQILAGLCVMSAAAIYTVRHPEWHLNSDYSYGFAYILAWVAFPLALLSGVIYVILRKRE
"
misc_feature 212..301
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q01453.1);
transmembrane region"
misc_feature 272..667
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; pfam00822"
/db_xref="CDD:109862"
misc_feature 329..331
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 401..481
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q01453.1);
transmembrane region"
misc_feature 494..565
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q01453.1);
transmembrane region"
misc_feature 608..676
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q01453.1);
transmembrane region"
exon 287..386
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="alignment:Splign:1.39.8"
exon 387..527
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="alignment:Splign:1.39.8"
STS 394..537
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/standard_name="GDB:189307"
/db_xref="UniSTS:155589"
variation 464
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="a"
/replace="c"
/db_xref="dbSNP:11545341"
exon 528..1828
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/inference="alignment:Splign:1.39.8"
STS 556..760
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/standard_name="GDB:335807"
/db_xref="UniSTS:156607"
STS 715..959
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/standard_name="G10646"
/db_xref="UniSTS:50030"
variation 750
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="a"
/replace="c"
/db_xref="dbSNP:13422"
variation 766
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="a"
/replace="g"
/db_xref="dbSNP:11545342"
variation 806
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace=""
/replace="caaac"
/db_xref="dbSNP:3833123"
variation 919
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="a"
/replace="g"
/db_xref="dbSNP:1804193"
STS 1184..1301
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/standard_name="G62085"
/db_xref="UniSTS:139089"
variation 1217
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace=""
/replace="ct"
/replace="t"
/db_xref="dbSNP:16418"
variation 1268
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="c"
/replace="t"
/db_xref="dbSNP:7538"
STS 1352..1593
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/standard_name="STS-D11428"
/db_xref="UniSTS:22583"
variation 1512
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="c"
/replace="g"
/db_xref="dbSNP:1803629"
variation 1519
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="a"
/replace="g"
/db_xref="dbSNP:13027"
variation 1576
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804192"
STS 1640..1746
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/standard_name="D17S2006"
/db_xref="UniSTS:50425"
variation 1802
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/replace="g"
/replace="t"
/db_xref="dbSNP:7415"
polyA_signal 1809..1814
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
polyA_site 1828
/gene="PMP22"
/gene_synonym="CMT1A; CMT1E; DSS; GAS-3; HMSNIA; HNPP;
Sp110"
/experiment="experimental evidence, no additional details
recorded"
ORIGIN
cagttacagggagcaccaccagggaacatctcggggagcctggttggaagctgcaggcttagtctgtcggctgcgggtctctgactgccctgtggggagggtcttgccttaacatcccttgcatttggctgcaaagaaatctgcttggaagaaggggttacgctgtttggccgggcagaaactccgctgagcagaacttgccgccagaatgctcctcctgttgctgagtatcatcgtcctccacgtcgcggtgctggtgctgctgttcgtctccacgatcgtcagccaatggatcgtgggcaatggacacgcaactgatctctggcagaactgtagcacctcttcctcaggaaatgtccaccactgtttctcatcatcaccaaacgaatggctgcagtctgtccaggccaccatgatcctgtcgatcatcttcagcattctgtctctgttcctgttcttctgccaactcttcaccctcaccaaggggggcaggttttacatcactggaatcttccaaattcttgctggtctgtgcgtgatgagtgctgcggccatctacacggtgaggcacccggagtggcatctcaactcggattactcctacggtttcgcctacatcctggcctgggtggccttccccctggcccttctcagcggtgtcatctatgtgatcttgcggaaacgcgaatgaggcgcccagacggtctgtctgaggctctgagcgtacatagggaagggaggaagggaaaacagaaagcagacaaagaaaaaagagctagcccaaaatcccaaactcaaaccaaaccaaacagaaagcagtggaggtgggggttgctgttgattgaagatgtatataatatctccggtttataaaacctatttataacactttttacatatatgtacatagtattgtttgctttttatgttgaccatcagcctcgtgttgagccttaaagaagtagctaaggaactttacatcctaacagtataatccagctcagtatttttgttttgttttttgtttgtttgttttgttttacccagaaataagataactccatctcgccccttccctttcatctgaaagaagatacctccctcccagtccacctcatttagaaaaccaaagtgtgggtagaaaccccaaatgtccaaaagcccttttctggtgggtgacccagtgcatccaacagaaacagccgctgcccgaacctctgtgtgaagctttacgcgcacacggacaaaatgcccaaactggagcccttgcaaaaacacggcttgtggcattggcatacttgcccttacaggtggagtatcttcgtcacacatctaaatgagaaatcagtgacaacaagtctttgaaatggtgctatggatttaccattccttattatcactaatcatctaaacaactcactggaaatccaattaacaattttacaacataagatagaatggagacctgaataattctgtgtaatataaatggtttataactgcttttgtacctagctaggctgctattattactataatgagtaaatcataaagccttcatcactcccacatttttcttacggtcggagcatcagaacaagcgtctagactccttgggaccgtgagttcctagagcttggctgggtctaggctgttctgtgcctccaaggactgtctggcaatgacttgtattggccaccaactgtagatgtatatatggtgcccttctgatgctaagactccagaccttttgtttttgctttgcattttctgattttataccaactgtgtggactaagatgcattaaaataaacatcagagtaactc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5376 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5376 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
GeneID:5376 -> Biological process: GO:0007422 [peripheral nervous system development] evidence: TAS
GeneID:5376 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IEA
GeneID:5376 -> Biological process: GO:0010977 [negative regulation of neuron projection development] evidence: IEA
GeneID:5376 -> Biological process: GO:0032288 [myelin assembly] evidence: IEA
GeneID:5376 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:5376 -> Cellular component: GO:0005923 [tight junction] evidence: IEA
GeneID:5376 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
GeneID:5376 -> Cellular component: GO:0043218 [compact myelin] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.