Home |
Help |
Advanced search
2025-05-09 18:41:13, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001105207 7372 bp mRNA linear PRI 28-MAY-2013
DEFINITION Homo sapiens laminin, alpha 4 (LAMA4), transcript variant 3, mRNA.
ACCESSION NM_001105207
VERSION NM_001105207.2 GI:380503845
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 7372)
AUTHORS Wang,Y., Fu,W., Xie,F., Wang,Y., Chu,X., Wang,H., Shen,M., Wang,Y.,
Wang,Y., Sun,W., Lei,R., Yang,L., Wu,H., Foo,J., Liu,J., Jin,L. and
Huang,W.
TITLE Common polymorphisms in ITGA2, PON1 and THBS2 are associated with
coronary atherosclerosis in a candidate gene association study of
the Chinese Han population
JOURNAL J. Hum. Genet. 55 (8), 490-494 (2010)
PUBMED 20485444
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 2 (bases 1 to 7372)
AUTHORS Senyurek,I., Klein,G., Kalbacher,H., Deeg,M. and Schittek,B.
TITLE Peptides derived from the human laminin alpha4 and alpha5 chains
exhibit antimicrobial activity
JOURNAL Peptides 31 (8), 1468-1472 (2010)
PUBMED 20433883
REMARK GeneRIF: Data from experiment with peptide fragments suggest
laminin alpha4 (and laminin alpha5) may be part of host defense
response and may protect tissues from invading pathogens.
REFERENCE 3 (bases 1 to 7372)
AUTHORS Lugassy,C., Torres-Munoz,J.E., Kleinman,H.K., Ghanem,G., Vernon,S.
and Barnhill,R.L.
TITLE Overexpression of malignancy-associated laminins and laminin
receptors by angiotropic human melanoma cells in a chick
chorioallantoic membrane model
JOURNAL J. Cutan. Pathol. 36 (12), 1237-1243 (2009)
PUBMED 19469865
REMARK GeneRIF: LAMC2, LAMA4, ITGB1, ITGB3, RSPA and MMP2) are
overexpressed in angiotropic melanoma cells vs. non-angiotropic
melanoma cells from the same tumor
REFERENCE 4 (bases 1 to 7372)
AUTHORS Sprenger,C.C., Drivdahl,R.H., Woodke,L.B., Eyman,D., Reed,M.J.,
Carter,W.G. and Plymate,S.R.
TITLE Senescence-induced alterations of laminin chain expression modulate
tumorigenicity of prostate cancer cells
JOURNAL Neoplasia 10 (12), 1350-1361 (2008)
PUBMED 19048114
REMARK GeneRIF: LM alpha4 and beta2 have roles in in vitro migration and
in vivo tumorigenicity of prostate cancer cells
REFERENCE 5 (bases 1 to 7372)
AUTHORS Xiao,S., Lux,M.L., Reeves,R., Hudson,T.J. and Fletcher,J.A.
TITLE HMGI(Y) activation by chromosome 6p21 rearrangements in
multilineage mesenchymal cells from pulmonary hamartoma
JOURNAL Am. J. Pathol. 150 (3), 901-910 (1997)
PUBMED 9060828
REFERENCE 6 (bases 1 to 7372)
AUTHORS Richards,A., Al-Imara,L. and Pope,F.M.
TITLE The complete cDNA sequence of laminin alpha 4 and its relationship
to the other human laminin alpha chains
JOURNAL Eur. J. Biochem. 238 (3), 813-821 (1996)
PUBMED 8706685
REFERENCE 7 (bases 1 to 7372)
AUTHORS Iivanainen,A., Sainio,K., Sariola,H. and Tryggvason,K.
TITLE Primary structure and expression of a novel human laminin alpha 4
chain
JOURNAL FEBS Lett. 365 (2-3), 183-188 (1995)
PUBMED 7781776
REFERENCE 8 (bases 1 to 7372)
AUTHORS Ryan,M.C., Tizard,R., VanDevanter,D.R. and Carter,W.G.
TITLE Cloning of the LamA3 gene encoding the alpha 3 chain of the
adhesive ligand epiligrin. Expression in wound repair
JOURNAL J. Biol. Chem. 269 (36), 22779-22787 (1994)
PUBMED 8077230
REFERENCE 9 (bases 1 to 7372)
AUTHORS Richards,A.J., al-Imara,L., Carter,N.P., Lloyd,J.C., Leversha,M.A.
and Pope,F.M.
TITLE Localization of the gene (LAMA4) to chromosome 6q21 and isolation
of a partial cDNA encoding a variant laminin A chain
JOURNAL Genomics 22 (1), 237-239 (1994)
PUBMED 7959779
REFERENCE 10 (bases 1 to 7372)
AUTHORS Burgeson,R.E., Chiquet,M., Deutzmann,R., Ekblom,P., Engel,J.,
Kleinman,H., Martin,G.R., Meneguzzi,G., Paulsson,M., Sanes,J. et
al.
TITLE A new nomenclature for the laminins
JOURNAL Matrix Biol. 14 (3), 209-211 (1994)
PUBMED 7921537
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BP234809.1, BC066552.1,
AB210027.1 and Z99289.1.
On Mar 16, 2012 this sequence version replaced gi:157419125.
Summary: Laminins, a family of extracellular matrix glycoproteins,
are the major noncollagenous constituent of basement membranes.
They have been implicated in a wide variety of biological processes
including cell adhesion, differentiation, migration, signaling,
neurite outgrowth and metastasis. Laminins are composed of 3 non
identical chains: laminin alpha, beta and gamma (formerly A, B1,
and B2, respectively) and they form a cruciform structure
consisting of 3 short arms, each formed by a different chain, and a
long arm composed of all 3 chains. Each laminin chain is a
multidomain protein encoded by a distinct gene. Several isoforms of
each chain have been described. Different alpha, beta and gamma
chain isomers combine to give rise to different heterotrimeric
laminin isoforms which are designated by Arabic numerals in the
order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is
laminin 1. The biological functions of the different chains and
trimer molecules are largely unknown, but some of the chains have
been shown to differ with respect to their tissue distribution,
presumably reflecting diverse functions in vivo. This gene encodes
the alpha chain isoform laminin, alpha 4. The domain structure of
alpha 4 is similar to that of alpha 3, both of which resemble
truncated versions of alpha 1 and alpha 2, in that approximately
1,200 residues at the N-terminus (domains IV, V and VI) have been
lost. Laminin, alpha 4 contains the C-terminal G domain which
distinguishes all alpha chains from the beta and gamma chains. The
RNA analysis from adult and fetal tissues revealed developmental
regulation of expression, however, the exact function of laminin,
alpha 4 is not known. Tissue-specific utilization of alternative
polyA-signal has been described in literature. Alternative splicing
results in multiple transcript variants encoding distinct isoforms.
[provided by RefSeq, Aug 2011].
Transcript Variant: This variant (3) uses alternate splice sites in
the 5' UTR and 5' coding region, compared to variant 1, resulting
in a shorter protein (isoform 2), compared to isoform 1. Variants 2
and 3 encode the same isoform (2).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC066552.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-5 BP234809.1 1-5
6-1885 BC066552.1 2-1881
1886-6171 AB210027.1 1742-6027
6172-7372 Z99289.1 50993-52193 c
FEATURES Location/Qualifiers
source 1..7372
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6q21"
gene 1..7372
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="laminin, alpha 4"
/db_xref="GeneID:3910"
/db_xref="HGNC:6484"
/db_xref="MIM:600133"
exon 1..274
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 275..610
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
misc_feature 326..328
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="upstream in-frame stop codon"
CDS 416..5866
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="isoform 2 precursor is encoded by transcript
variant 3; laminin subunit alpha-4; laminin alpha 4 chain"
/codon_start=1
/product="laminin subunit alpha-4 isoform 2 precursor"
/protein_id="NP_001098677.2"
/db_xref="GI:380503846"
/db_xref="CCDS:CCDS34514.1"
/db_xref="GeneID:3910"
/db_xref="HGNC:6484"
/db_xref="MIM:600133"
/translation="
MALSSAWRSVLPLWLLWSAACSRAASGDDNAFPFDIEGSSAVGRQDPPETSEPRVALGRLPPAAEKCNAGFFHTLSGECVPCDCNGNSNECLDGSGYCVHCQRNTTGEHCEKCLDGYIGDSIRGAPQFCQPCPCPLPHLANFAESCYRKNGAVRCICNENYAGPNCERCAPGYYGNPLLIGSTCKKCDCSGNSDPNLIFEDCDEVTGQCRNCLRNTTGFKCERCAPGYYGDARIAKNCAVCNCGGGPCDSVTGECLEEGFEPPTGCDKCVWDLTDDLRLAALSIEEGKSGVLSVSSGAAAHRHVNEINATIYLLKTKLSERENQYALRKIQINNAENTMKSLLSDVEELVEKENQASRKGQLVQKESMDTINHASQLVEQAHDMRDKIQEINNKMLYYGEEHELSPKEISEKLVLAQKMLEEIRSRQPFFTQRELVDEEADEAYELLSQAESWQRLHNETRTLFPVVLEQLDDYNAKLSDLQEALDQALNYVRDAEDMNRATAARQRDHEKQQERVREQMEVVNMSLSTSADSLTTPRLTLSELDDIIKNASGIYAEIDGAKSELQVKLSNLSNLSHDLVQEAIDHAQDLQQEANELSRKLHSSDMNGLVQKALDASNVYENIVNYVSEANETAEFALNTTDRIYDAVSGIDTQIIYHKDESENLLNQARELQAKAESSSDEAVADTSRRVGGALARKSALKTRLSDAVKQLQAAERGDAQQRLGQSRLITEEANRTTMEVQQATAPMANNLTNWSQNLQHFDSSAYNTAVNSARDAVRNLTEVVPQLLDQLRTVEQKRPASNVSASIQRIRELIAQTRSVASKIQVSMMFDGQSAVEVHSRTSMDDLKAFTSLSLYMKPPVKRPELTETADQFILYLGSKNAKKEYMGLAIKNDNLVYVYNLGTKDVEIPLDSKPVSSWPAYFSIVKIERVGKHGKVFLTVPSLSSTAEEKFIKKGEFSGDDSLLDLDPEDTVFYVGGVPSNFKLPTSLNLPGFVGCLELATLNNDVISLYNFKHIYNMDPSTSVPCARDKLAFTQSRAASYFFDGSGYAVVRDITRRGKFGQVTRFDIEVRTPADNGLILLMVNGSMFFRLEMRNGYLHVFYDFGFSGGPVHLEDTLKKAQINDAKYHEISIIYHNDKKMILVVDRRHVKSMDNEKMKIPFTDIYIGGAPPEILQSRALRAHLPLDINFRGCMKGFQFQKKDFNLLEQTETLGVGYGCPEDSLISRRAYFNGQSFIASIQKISFFDGFEGGFNFRTLQPNGLLFYYASGSDVFSISLDNGTVIMDVKGIKVQSVDKQYNDGLSHFVISSVSPTRYELIVDKSRVGSKNPTKGKIEQTQASEKKFYFGGSPISAQYANFTGCISNAYFTRVDRDVEVEDFQRYTEKVHTSLYECPIESSPLFLLHKKGKNLSKPKASQNKKGGKSKDAPSWDPVALKLPERNTPRNSHCHLSNSPRAIEHAYQYGGTANSRQEFEHLKGDFGAKSQFSIRLRTRSSHGMIFYVSDQEENDFMTLFLAHGRLVYMFNVGHKKLKIRSQEKYNDGLWHDVIFIRERSSGRLVIDGLRVLEESLPPTEATWKIKGPIYLGGVAPGKAVKNVQINSIYSFSGCLSNLQLNGASITSASQTFSVTPCFEGPMETGTYFSTEGGYVVLDESFNIGLKFEIAFEVRPRSSSGTLVHGHSVNGEYLNVHMKNGQVIVKVNNGIRDFSTSVTPKQSLCDGRWHRITVIRDSNVVQLDVDSEVNHVVGPLNPKPIDHREPVFVGGVPESLLTPRLAPSKPFTGCIRHFVIDGHPVSFSKAALVSGAVSINSCPAA
"
sig_peptide 416..496
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 497..5863
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/product="laminin subunit alpha-4 isoform 2"
misc_feature 656..787
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin-type epidermal growth factor-like domain;
laminins are the major noncollagenous components of
basement membranes that mediate cell adhesion, growth
migration, and differentiation; the laminin-type epidermal
growth factor-like module occurs in...; Region: EGF_Lam;
cd00055"
/db_xref="CDD:28937"
misc_feature 659..778
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin EGF-like (Domains III and V); Region:
Laminin_EGF; pfam00053"
/db_xref="CDD:200961"
misc_feature order(659..661,665..667,686..688,707..709,716..718,
743..745)
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="EGF-like motif; other site"
/db_xref="CDD:28937"
misc_feature 827..967
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin EGF-like (Domains III and V); Region:
Laminin_EGF; pfam00053"
/db_xref="CDD:200961"
misc_feature 833..970
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin-type epidermal growth factor-like domain;
laminins are the major noncollagenous components of
basement membranes that mediate cell adhesion, growth
migration, and differentiation; the laminin-type epidermal
growth factor-like module occurs in...; Region: EGF_Lam;
cd00055"
/db_xref="CDD:28937"
misc_feature order(851..853,878..880,884..886,911..913)
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="EGF-like motif; other site"
/db_xref="CDD:28937"
misc_feature 974..1129
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin-type epidermal growth factor-like domain;
laminins are the major noncollagenous components of
basement membranes that mediate cell adhesion, growth
migration, and differentiation; the laminin-type epidermal
growth factor-like module occurs in...; Region: EGF_Lam;
cd00055"
/db_xref="CDD:28937"
misc_feature 974..1114
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin EGF-like (Domains III and V); Region:
Laminin_EGF; pfam00053"
/db_xref="CDD:200961"
misc_feature order(974..976,980..982,1019..1021,1040..1042,1049..1051,
1076..1078)
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="EGF-like motif; other site"
/db_xref="CDD:28937"
misc_feature 1316..2059
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin Domain I; Region: Laminin_I; pfam06008"
/db_xref="CDD:191425"
misc_feature 1409..1999
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Spectrin repeats, found in several proteins
involved in cytoskeletal structure; family members include
spectrin, alpha-actinin and dystrophin; the spectrin
repeat forms a three helix bundle with the second helix
interrupted by proline in some sequences; Region: SPEC;
cd00176"
/db_xref="CDD:29138"
misc_feature 1682..1699
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="linker region; other site"
/db_xref="CDD:29138"
misc_feature 1715..2566
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Uncharacterized archaeal coiled-coil protein
[Function unknown]; Region: COG1340"
/db_xref="CDD:31531"
misc_feature 2417..>2965
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="HlyD family secretion protein; Region: HlyD;
pfam00529"
/db_xref="CDD:109580"
misc_feature 2594..2977
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin Domain II; Region: Laminin_II; pfam06009"
/db_xref="CDD:203372"
misc_feature 2897..3430
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin G domain; Laminin G-like domains are
usually Ca++ mediated receptors that can have binding
sites for steroids, beta1 integrins, heparin, sulfatides,
fibulin-1, and alpha-dystroglycans. Proteins that contain
LamG domains serve a variety of...; Region: LamG; cd00110"
/db_xref="CDD:29010"
misc_feature 3539..4015
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin G domain; Laminin G-like domains are
usually Ca++ mediated receptors that can have binding
sites for steroids, beta1 integrins, heparin, sulfatides,
fibulin-1, and alpha-dystroglycans. Proteins that contain
LamG domains serve a variety of...; Region: LamG; cd00110"
/db_xref="CDD:29010"
misc_feature 4103..4522
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin G domain; Laminin G-like domains are
usually Ca++ mediated receptors that can have binding
sites for steroids, beta1 integrins, heparin, sulfatides,
fibulin-1, and alpha-dystroglycans. Proteins that contain
LamG domains serve a variety of...; Region: LamG; cd00110"
/db_xref="CDD:29010"
misc_feature 4859..5266
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin G domain; Laminin G-like domains are
usually Ca++ mediated receptors that can have binding
sites for steroids, beta1 integrins, heparin, sulfatides,
fibulin-1, and alpha-dystroglycans. Proteins that contain
LamG domains serve a variety of...; Region: LamG; cd00110"
/db_xref="CDD:29010"
misc_feature 5339..5791
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/note="Laminin G domain; Laminin G-like domains are
usually Ca++ mediated receptors that can have binding
sites for steroids, beta1 integrins, heparin, sulfatides,
fibulin-1, and alpha-dystroglycans. Proteins that contain
LamG domains serve a variety of...; Region: LamG; cd00110"
/db_xref="CDD:29010"
variation 522
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:70940809"
exon 611..712
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 695
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:35349917"
exon 713..837
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 838..918
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 919..1133
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 1134..1208
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 1209..1360
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 1361..1471
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 1366
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="c"
/db_xref="dbSNP:70940813"
exon 1472..1583
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 1584..1751
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 1752..1945
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 1886
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1050348"
exon 1946..2062
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 2063..2211
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 2212..2353
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 2354..2450
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 2451..2567
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 2539
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:70940810"
exon 2568..2747
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 2748..2887
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 2888..3061
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 3049
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35772073"
exon 3062..3207
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 3204
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:35605307"
exon 3208..3370
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 3371..3504
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 3505..3676
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 3677..3808
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 3750
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="g"
/db_xref="dbSNP:1050349"
exon 3809..3951
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 3952..4090
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 4091..4228
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 4229..4362
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 4337
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:70940811"
exon 4363..4527
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 4459
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:34753919"
exon 4528..4681
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 4567
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35042032"
exon 4682..4869
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 4870..5059
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 4952
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:34256052"
exon 5060..5215
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 5110
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35679345"
exon 5216..5375
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 5376..5506
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 5507..5600
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
variation 5554
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1050353"
exon 5601..5720
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
exon 5721..7372
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/inference="alignment:Splign:1.39.8"
STS 5836..5946
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/standard_name="D6S1133E"
/db_xref="UniSTS:35049"
variation 5837
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3734292"
variation 5913
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11495"
STS 5988..6114
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/standard_name="RH18133"
/db_xref="UniSTS:76207"
variation 6083
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/replace="a"
/replace="t"
/db_xref="dbSNP:1050447"
polyA_signal 6148..6153
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
polyA_site 6174
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
STS 7205..7304
/gene="LAMA4"
/gene_synonym="CMD1JJ; LAMA3; LAMA4*-1"
/standard_name="A006N46"
/db_xref="UniSTS:28608"
ORIGIN
gaatattcttctggagcccttggaggggctccaaactgagaggggagggaagaccgcagggaaaggcggacctcagtgtctgaaaagccagcttagagtgggagggcctgggagtagaaggtaaaaagggagtggtgagaatgaatgtgagaaggaagccaggacagcgcagtccccagtcccgaacggccagggagaggaggtggcctagcgctggcggggctcaccccaatccgtctgccttttgatgccgtactgtaagctccgtccatctctgctggttgcgcagccacctcgggatactgcacacggagaggagggaaaataagcgaggcaccgccgcaccacgcgggagacctacggagacccacagcgcccgagccctggaagagcactactggatgtcagcggagaaatggctttgagctcagcctggcgctcggttctgcctctgtggctcctctggagcgctgcctgctcccgcgccgcgtccggggacgacaacgcttttccttttgacattgaagggagctcagcggttggcaggcaagacccgcctgagacgagcgaaccccgcgtggctctgggacgcctgccgcctgcggccgagaaatgcaatgctggattctttcacaccctgtcgggagaatgtgtgccctgcgactgtaatggcaattccaacgagtgtttggacggctcaggatactgtgtgcactgccagcggaacacaacaggagagcactgtgaaaagtgtctggatggttatatcggagattccatcaggggagcaccccaattctgccagccgtgcccctgtcccctgccccacttggccaattttgcagaatcctgctataggaaaaatggagctgttcggtgcatttgtaacgaaaattatgctggacctaactgtgaaagatgtgctcccggttactatggaaaccccttactcattggaagcacctgtaagaaatgtgactgcagtggaaattcagatcccaacctgatctttgaagattgtgatgaagtcactggccagtgtaggaattgcttacgcaacaccaccggattcaagtgtgaacgttgcgctcctggctactatggggacgccaggatagccaagaactgtgcagtgtgcaactgcgggggaggcccatgtgacagtgtaaccggagaatgcttggaagaaggttttgaaccccctacaggctgtgataagtgcgtctgggacctgactgatgacctgcggttagcagcgctctccatcgaggaaggcaaatccggggtgctgagcgtatcctctggggccgccgctcataggcacgtgaatgaaatcaacgccaccatctacctcctcaaaacaaaattgtcagaaagagaaaaccaatacgccctaagaaagatacaaatcaacaatgctgagaacacgatgaaaagccttctgtctgacgtagaggaattagttgaaaaggaaaatcaagcctccagaaaaggacaacttgttcagaaggaaagcatggacaccattaaccacgcaagtcagctggtagagcaagcccatgatatgagggataaaatccaagagatcaacaacaagatgctctattatggggaagagcatgaacttagccccaaggaaatctctgagaagctggtgttggcccagaagatgcttgaagagattagaagccgtcaaccatttttcacccaacgggagctcgtggatgaggaggcagatgaggcttacgaactactgagccaggctgagagctggcagcggctgcacaatgagacccgcactctgtttcctgtcgtcctggagcagctggatgactacaatgctaagttgtcagatctccaggaagcacttgaccaggcccttaactatgtcagggatgccgaagacatgaacagggccacagcagccaggcagcgggaccatgagaaacaacaggaaagagtgagggaacaaatggaagtggtgaacatgtctctgagcacatctgcggactctctgacaacacctcgtctaactctttcagaacttgatgatataataaagaatgcgtcagggatttatgcagaaatagatggagccaaaagtgaactacaagtaaaactatctaacctaagtaacctcagccatgatttagtccaagaagctattgaccatgcacaggaccttcaacaagaagctaatgaattgagcaggaagttgcacagttcagatatgaacgggctggtacagaaggctttggatgcatcaaatgtctatgaaaatattgttaattatgttagtgaagccaatgaaacagcagaatttgctttgaacaccactgaccgaatttatgatgcggtgagtgggattgatactcaaatcatttaccataaagatgaaagtgagaacctcctcaatcaagccagagaactgcaagcaaaggcagagtctagcagtgatgaagcagtggctgacactagcaggcgtgtgggtggagccctagcaaggaaaagtgcccttaaaaccagactcagtgatgccgttaagcaactacaagcagcagagagaggggatgcccagcagcgcctggggcagtctagactgatcaccgaggaagccaacaggacgacgatggaggtgcagcaggccactgcccccatggccaacaatctaaccaactggtcacagaatcttcaacattttgactcttctgcttacaacactgcagtgaactctgctagggatgcagtaagaaatctgaccgaggttgtccctcagctcctggatcagcttcgtacggttgagcagaagcgacctgcaagcaacgtttctgccagcatccagaggatccgagagctcattgctcagaccagaagtgttgccagcaagatccaagtctccatgatgtttgatggccagtcagctgtggaagtgcactcgagaaccagtatggatgacttaaaggccttcacgtctctgagcctgtacatgaaaccccctgtgaagcggccggaactgaccgagactgcagatcagtttatcctgtacctcggaagcaaaaacgccaaaaaagagtatatgggtcttgcaatcaaaaatgataatctggtatacgtctataatttgggaactaaagatgtggagattcccctggactccaagcccgtcagttcctggcctgcttacttcagcattgtcaagattgaaagggtgggaaaacatggaaaggtgtttttaacagtcccgagtctaagtagcacagcagaggaaaagttcattaaaaagggggaattttcgggagatgactctctgctggacctggaccctgaggacacagtgttttatgttggtggagtgccttccaacttcaagctccctaccagcttaaacctgcctggctttgttggctgcctggaactggccactttgaataatgatgtgatcagcttgtacaactttaagcacatctataatatggacccctccacatcagtgccatgtgcccgagataagctggccttcactcagagtcgggctgccagttacttcttcgatggctccggttatgccgtggtgagagacatcacaaggagagggaaatttggtcaggtgactcgctttgacatagaagttcgaacaccagctgacaacggccttattctcctgatggtcaatggaagtatgtttttcagactggaaatgcgcaatggttacctacatgtgttctatgattttggattcagcggtggccctgtgcatcttgaagatacgttaaagaaagctcaaattaatgatgcaaaataccatgagatctcaatcatttaccacaatgataagaaaatgatcttggtagttgacagaaggcatgtcaagagcatggataatgaaaagatgaaaataccttttacagatatatacattggaggagctcctccagaaatcttacaatccagggccctcagagcacaccttcccctagatatcaacttcagaggatgcatgaagggcttccagttccaaaagaaggacttcaatttactggagcagacagaaaccctgggagttggttatggatgcccagaagactcacttatatctcgcagagcatatttcaatggacagagcttcattgcttcaattcagaaaatatctttctttgatggctttgaaggaggttttaatttccgaacattacaaccaaatgggttactattctattatgcttcagggtcagacgtgttctccatctcactggataatggtactgtcatcatggatgtaaagggaatcaaagttcagtcagtagataagcagtacaatgatgggctgtcccacttcgtcattagctctgtctcacccacaagatatgaactgatagtagataaaagcagagttgggagtaagaatcctaccaaagggaaaatagaacagacacaagcaagtgaaaagaagttttacttcggtggctcaccaatcagtgctcagtatgctaatttcactggctgcataagtaatgcctactttaccagggtggatagagatgtggaggttgaagatttccaacggtatactgaaaaggtccacacttctctttatgagtgtcccattgagtcttcaccattgtttctcctccataaaaaaggaaaaaatttatccaagcctaaagcaagtcagaataaaaagggagggaaaagtaaagatgcaccttcatgggatcctgttgctctgaaactcccagagcggaatactccaagaaactctcattgccacctttccaacagccctagagcaatagagcacgcctatcaatatggaggaacagccaacagccgccaagagtttgaacacttaaaaggagattttggtgccaaatctcagttttccattcgtctgagaactcgttcctcccatggcatgatcttctatgtctcagatcaagaagagaatgacttcatgactctatttttggcccatggccgcttggtttacatgtttaatgttggtcacaaaaaactgaagattagaagccaggagaaatacaatgatggcctgtggcatgatgtgatatttattcgagaaaggagcagtggccgactggtaattgatggtctccgagtcctagaagaaagtcttcctcctactgaagctacctggaaaatcaagggtcccatttatttgggaggtgtggctcctggaaaggctgtgaaaaatgttcagattaactccatctacagttttagtggctgtctcagcaatctccagctcaatggggcctccatcacctctgcttctcagacattcagtgtgaccccttgctttgaaggccccatggaaacaggaacttacttttcaacagaaggaggatacgtggttctagatgaatctttcaatattggattgaagtttgaaattgcatttgaagtccgtcccagaagcagttccggaaccctggtccacggccacagtgtcaatggggagtacctaaatgttcacatgaaaaatggacaggtcatagtgaaagtcaataatggcatcagagatttttccacctcagttacacccaagcagagtctctgtgatggcagatggcacagaattacagttattagagattctaatgtggttcagttggatgtggactctgaagtgaaccatgtggttggacccctgaatccaaaaccaattgatcacagggagcctgtgtttgttggaggtgttccagaatctctactgacaccacgcttggcccccagcaaacccttcacaggctgcatacgccactttgtgattgatggacacccagtgagcttcagtaaagcagccctggtcagcggcgccgtaagcatcaactcctgtccagcagcctgacatgacagagcacagctgcccaaatacaaagttctttagagcactgaaagaaacacaaagccagccaggaggaacagtaactcttccttcgggtggaagctttcatcgagttgaacaggacttaaacgaatcatcagggaccggatatttcttatttctcatttggattcttaaccttgaatccaaagtgtctgcaatggacaacaattgaaggagtggcaaacttacttgtattgagagcacacgcaattcctactggtgaaattactgtttctgtttctaataaaatagaagggattccaaataaacacttgcacacatttttgaagtgcggctagattctcagattcacctttcttccagggaagataactttcaatctatataaaaatctctgtcctaaaactacctttctttattttgaagagacttactaacttacatataatctaaattagatgatagatttgtttttagcccttttgtttggtctatcagtataagaagaatattttaggtttatagctgaagttatcaaggtttaataaagtaaatttctaacagaatactagaaaaatgcagtataatttaattttttctaaataagaaacacaggaaatcaactactttttccccttccttatctccttaaaagaaaaataaaattgtacatgagaggaggcttctgtaggttattattaccattattgtgtgttctatgggaatcattgaggatatcacagcaaaaacagtaggacaaaatcataaaattcaatttaagagtacacaagtccttttattaaaagtttgctcctagcctgggcaacataatgagatcccatctctgcaaaaaaatttgtacatgggcatacacctgtagtcccagctacttgggaggctgagacgggaggatcgcttaagctcaggagttcaaggctgcagtgagctatgactgctgactgtacctgcactccagcctgggcaacagagtgagatcctgtctcaaaaacaaagtgtgctctccacatacctgcaacacaactagtcttatttctaaaatgttataatcttttttccaagtagctacattaatatagtctagaaaaaaatggacttgaatagctggtagaatattaaaatatagaaatgaaataaaagaattatatctaaaaacctcaactcagaagacagaaaaagagaaaataggccctgatatcaacagaattaacaatacataaaaggagtaacttttgaggggagaggatataaaatattttgaggaattaccaaggggaataaaacaatgttaccttgaaatgattatatatatattacatattggtatatatgtccatacctacctatatcccctgctacccttctgtctgaaatatacaaataatgataatgttgaagatatcgataaacatagctaatgtctgttcatagaggacttactaagtgccagccaccatgataagctaaagttaattattttatttgttc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3910 -> Molecular function: GO:0005102 [receptor binding] evidence: IEA
GeneID:3910 -> Molecular function: GO:0005201 [extracellular matrix structural constituent] evidence: TAS
GeneID:3910 -> Biological process: GO:0001568 [blood vessel development] evidence: IEA
GeneID:3910 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
GeneID:3910 -> Biological process: GO:0030155 [regulation of cell adhesion] evidence: IEA
GeneID:3910 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:3910 -> Biological process: GO:0030334 [regulation of cell migration] evidence: IEA
GeneID:3910 -> Biological process: GO:0045995 [regulation of embryonic development] evidence: IEA
GeneID:3910 -> Biological process: GO:0050873 [brown fat cell differentiation] evidence: IEA
GeneID:3910 -> Cellular component: GO:0005604 [basement membrane] evidence: IDA
GeneID:3910 -> Cellular component: GO:0005605 [basal lamina] evidence: TAS
GeneID:3910 -> Cellular component: GO:0005606 [laminin-1 complex] evidence: IEA
GeneID:3910 -> Cellular component: GO:0031012 [extracellular matrix] evidence: ISS
GeneID:3910 -> Cellular component: GO:0070062 [extracellular vesicular exosome] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.