GGRNA Home | Help | Advanced search

2025-05-09 18:56:41, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_032597               3353 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
            (MS4A14), transcript variant 1, mRNA.
ACCESSION   NM_032597 XM_495876
VERSION     NM_032597.4  GI:387849340
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3353)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP003127.2 and AY094610.1.
            On May 17, 2012 this sequence version replaced gi:119226216.
            
            Transcript Variant: This variant (1) has multiple coding region
            differences, compared to variant 4, which results in a shorter
            protein (isoform 1), compared to isoform 4.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY094610.1, AF367473.2 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-472               AP003127.2         99935-100406
            473-1093            AY094610.1         57-677
            1094-3353           AP003127.2         119418-121677
FEATURES             Location/Qualifiers
     source          1..3353
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q12.2"
     gene            1..3353
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="membrane-spanning 4-domains, subfamily A, member
                     14"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
     exon            1..703
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       31
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186234557"
     variation       39
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7929046"
     variation       40
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190992915"
     variation       51..52
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:377307026"
     variation       102
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76333679"
     variation       110
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143358541"
     variation       149
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3816270"
     variation       223
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76174817"
     variation       281
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180800488"
     variation       296
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185942516"
     variation       379
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141665394"
     misc_feature    410..412
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="upstream in-frame stop codon"
     variation       421
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112785513"
     variation       427
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375045470"
     variation       432
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190864604"
     variation       472
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6591579"
     variation       517
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368431455"
     variation       545
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367878785"
     variation       560
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592380"
     CDS             566..2605
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="isoform 1 is encoded by transcript variant 1;
                     membrane-spanning 4-domains, subfamily A, member 16;
                     testes development-related NYD-SP21; MS4A13 protein;
                     testis development protein NYD-SP21"
                     /codon_start=1
                     /product="membrane-spanning 4-domains subfamily A member
                     14 isoform 1"
                     /protein_id="NP_115986.3"
                     /db_xref="GI:119226217"
                     /db_xref="CCDS:CCDS31569.1"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
                     /translation="
MESTSQDRRATHVITIKPNETVLTAFPYRPHSSLLDFLKGEPRVLGATQILLALIIVGFGTIFALNYIGFSQRLPLVVLTGYPFWGALIFILTGYLTVTDKKSKLLGQGVTGMNVISSLVAITGITFTILSYRHQDKYCQMPSFEEICVFSRTLFIVLFFLPSDVTQNSEQPAPEENDQLQFVLQEEFSSDDSTTNAQSVIFGGYAFFKLTLSRSPLVSQPGNKGREFVPDEQKQSILPSPKFSEEEIEPLPPTLEKKPSENMSIQLDSTFKQMKDEDLQSAIVQPSQMQTKLLQDQAASLQVFPSHSALKLEDISPEDLPSQALPVEGLSEQTMPSKSTSSHVKQSSNLTANDLPPQGILSQDTSSQDMLFHDMTSQDMQSLDMLSQDTPSHAMPPQDIPSQDMLSQALSAHAILPEASTSHIVQFPEIQHLLQQPPDLQPENTEPQNQQILQMSYQDIRSEVMEETKEWKSEEELHRRKSSRRHSLNQQTKALQYLRRHSLDVQAKGQKSSKRHSLDQQSKGWQSPKQKSLDQQIKDWLSPKRHSVDKQAQLNQTKEQLPDQQAEDQQAKGEQYPEGQSKDGQVKDQQTDKEQNSKKQTQDQQTEDQPAQEKKSPKGQFQNVQAEGQQAQVEKVPKLLCQDSESQIQQYQFWQFHKGNLQAGQPRTVNLLAKNPLTG
"
     misc_feature    695..>1024
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="CD20-like family; Region: CD20; pfam04103"
                     /db_xref="CDD:202888"
     misc_feature    713..775
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
                     transmembrane region"
     misc_feature    791..853
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
                     transmembrane region"
     misc_feature    893..955
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
                     transmembrane region"
     misc_feature    986..1048
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96JA4.2);
                     transmembrane region"
     variation       569
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201462421"
     variation       577
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375301622"
     variation       589
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140226757"
     variation       601
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200092161"
     variation       602
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371634910"
     variation       640
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150323558"
     variation       653
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200017443"
     variation       701
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138895874"
     exon            704..832
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141700245"
     variation       731
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:72514098"
     variation       732..733
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:3217518"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74733740"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:77630012"
     variation       747
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147119308"
     variation       769
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138517611"
     variation       770
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368053345"
     variation       771
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144076317"
     variation       794
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369576834"
     variation       796
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144248317"
     variation       802
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2197234"
     variation       810
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372708908"
     variation       815
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148297999"
     variation       827
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375255532"
     variation       831
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141490187"
     exon            833..883
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       836
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367787186"
     variation       853
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77796224"
     variation       882
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139149393"
     exon            884..1033
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       884
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375760675"
     variation       885
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202236686"
     variation       897
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146613208"
     variation       898
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371907012"
     variation       907
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183715072"
     variation       927
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76136794"
     variation       932
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375247098"
     variation       942
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146035561"
     variation       961
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140270120"
     variation       1011
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145354751"
     exon            1034..3353
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1054
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371774895"
     variation       1065
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375761169"
     variation       1079
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143463721"
     variation       1094
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7131283"
     variation       1095
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148391374"
     variation       1142
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369024994"
     variation       1148
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142563385"
     variation       1158
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373780418"
     variation       1166
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116626186"
     variation       1171
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140195795"
     variation       1197
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142269991"
     variation       1203
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147713621"
     variation       1204
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142667482"
     variation       1215
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370208539"
     variation       1253
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373858678"
     variation       1256
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150268605"
     variation       1313
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117801657"
     variation       1316
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149338262"
     variation       1352
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187868937"
     variation       1398
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150868984"
     variation       1414
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193025815"
     variation       1415
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368158780"
     variation       1416
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375278465"
     variation       1421
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114064661"
     variation       1437
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138285006"
     variation       1442
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142839945"
     variation       1462
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369608879"
     variation       1473
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185708225"
     variation       1510
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201469306"
     variation       1516
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114663860"
     variation       1525
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376669252"
     variation       1536
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139364741"
     variation       1542
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149681158"
     variation       1562
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150784858"
     variation       1612
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370940283"
     variation       1641
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145539034"
     variation       1661
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149868650"
     variation       1672
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144883718"
     variation       1709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140428922"
     variation       1745
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144301602"
     variation       1779
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116345276"
     variation       1801
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112103602"
     variation       1833
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369619070"
     variation       1861
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373220783"
     variation       1873..1874
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35183103"
     variation       1917
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3802959"
     variation       1948
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143398166"
     variation       1959
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139435636"
     variation       1966
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145054362"
     variation       2004
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140456628"
     variation       2018
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376488191"
     variation       2056
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150409796"
     variation       2061
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74837900"
     variation       2077
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142892172"
     variation       2092
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145051590"
     variation       2109
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199805024"
     variation       2133
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199505839"
     variation       2136
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374402343"
     variation       2147
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201227484"
     variation       2170
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142235413"
     variation       2202
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113290465"
     variation       2206
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80173276"
     variation       2207
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144635507"
     variation       2220
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372468983"
     variation       2242
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370935983"
     variation       2292
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200738251"
     variation       2293
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148489703"
     variation       2300
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897716"
     variation       2315
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3825020"
     variation       2341
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374558627"
     variation       2394
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116224124"
     variation       2401
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73481226"
     variation       2411
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200543306"
     variation       2415
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144309625"
     variation       2416
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726394"
     variation       2423
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200307761"
     variation       2430
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3016727"
     variation       2443
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147367847"
     variation       2444
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936913"
     variation       2459
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368186934"
     variation       2461
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146179294"
     variation       2473
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370794980"
     variation       2482
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375353153"
     variation       2502
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145801550"
     variation       2526
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368014397"
     variation       2528
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149015522"
     variation       2586
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142968938"
     variation       2591
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151183005"
     variation       2624
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181547264"
     variation       2732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77025492"
     variation       2842
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184474834"
     variation       2942
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375774697"
     variation       2964
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443243"
     STS             2994..3187
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="RH17567"
                     /db_xref="UniSTS:70207"
     variation       3053
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78731118"
     variation       3132
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375396734"
     STS             3150..3249
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="SGC34191"
                     /db_xref="UniSTS:21339"
     variation       3168
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75538311"
     variation       3190
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138237921"
     variation       3198
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188971082"
     variation       3289..3290
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="aacac"
                     /db_xref="dbSNP:140068962"
     variation       3330
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181921480"
ORIGIN      
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttatttttattcttacaggatacctcacagtaaccgataagaaatcaaaacttctgggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.