GGRNA Home | Help | Advanced search

2025-05-09 18:59:23, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001261828            3452 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
            (MS4A14), transcript variant 4, mRNA.
ACCESSION   NM_001261828
VERSION     NM_001261828.1  GI:387849349
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3452)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP003127.2, BC064627.1 and DB727789.1.
            
            Transcript Variant: This variant (4) encodes the longest isoform
            (4).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DB727789.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-472               AP003127.2         99935-100406
            473-731             BC064627.1         7-265
            732-733             AP003127.2         101801-101802
            734-1033            BC064627.1         266-565
            1034-1133           DB727789.1         551-650
            1134-3452           AP003127.2         119359-121677
FEATURES             Location/Qualifiers
     source          1..3452
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q12.2"
     gene            1..3452
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="membrane-spanning 4-domains, subfamily A, member
                     14"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
     exon            1..703
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       31
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186234557"
     variation       39
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7929046"
     variation       40
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190992915"
     variation       51..52
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:377307026"
     variation       102
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76333679"
     variation       110
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143358541"
     variation       149
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3816270"
     variation       223
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76174817"
     variation       281
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180800488"
     variation       296
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185942516"
     variation       379
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141665394"
     misc_feature    410..412
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="upstream in-frame stop codon"
     variation       421
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112785513"
     variation       427
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375045470"
     variation       432
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190864604"
     variation       472
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6591579"
     variation       517
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368431455"
     variation       545
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367878785"
     variation       560
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592380"
     CDS             566..2704
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="isoform 4 is encoded by transcript variant 4;
                     membrane-spanning 4-domains, subfamily A, member 16;
                     testes development-related NYD-SP21; MS4A13 protein;
                     testis development protein NYD-SP21"
                     /codon_start=1
                     /product="membrane-spanning 4-domains subfamily A member
                     14 isoform 4"
                     /protein_id="NP_001248757.1"
                     /db_xref="GI:387849350"
                     /db_xref="CCDS:CCDS58136.1"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
                     /translation="
MESTSQDRRATHVITIKPNETVLTAFPYRPHSSLLDFLKGEPRVLGATQILLALIIVGFGTIFALNYIGFSQRLPLVVLTGYPFWGALIFILTGYLTVTDKKSKLLGQGVTGMNVISSLVAITGITFTILSYRHQDKYCQMPSFEEICVFSRTLFIGILLILLIISIAELSISVTIASFRSKCWTQSDEVLFFLPSDVTQNSEQPAPEENDQLQFVLQEEFSSDDSTTNAQSVIFGGYAFFKLTLSRSPLVSQPGNKGREFVPDEQKQSILPSPKFSEEEIEPLPPTLEKKPSENMSIQLDSTFKQMKDEDLQSAIVQPSQMQTKLLQDQAASLQVFPSHSALKLEDISPEDLPSQALPVEGLSEQTMPSKSTSSHVKQSSNLTANDLPPQGILSQDTSSQDMLFHDMTSQDMQSLDMLSQDTPSHAMPPQDIPSQDMLSQALSAHAILPEASTSHIVQFPEIQHLLQQPPDLQPENTEPQNQQILQMSYQDIRSEVMEETKEWKSEEELHRRKSSRRHSLNQQTKALQYLRRHSLDVQAKGQKSSKRHSLDQQSKGWQSPKQKSLDQQIKDWLSPKRHSVDKQAQLNQTKEQLPDQQAEDQQAKGEQYPEGQSKDGQVKDQQTDKEQNSKKQTQDQQTEDQPAQEKKSPKGQFQNVQAEGQQAQVEKVPKLLCQDSESQIQQYQFWQFHKGNLQAGQPRTVNLLAKNPLTG
"
     misc_feature    695..>1024
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="CD20-like family; Region: CD20; pfam04103"
                     /db_xref="CDD:202888"
     variation       569
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201462421"
     variation       577
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375301622"
     variation       589
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140226757"
     variation       601
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200092161"
     variation       602
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371634910"
     variation       640
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150323558"
     variation       653
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200017443"
     variation       701
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138895874"
     exon            704..832
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141700245"
     variation       731
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:72514098"
     variation       732..733
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:3217518"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74733740"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:77630012"
     variation       747
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147119308"
     variation       769
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138517611"
     variation       770
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368053345"
     variation       771
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144076317"
     variation       794
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369576834"
     variation       796
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144248317"
     variation       802
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2197234"
     variation       810
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372708908"
     variation       815
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148297999"
     variation       827
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375255532"
     variation       831
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141490187"
     exon            833..883
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       836
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367787186"
     variation       853
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77796224"
     variation       882
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139149393"
     exon            884..1033
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       884
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375760675"
     variation       885
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202236686"
     variation       897
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146613208"
     variation       898
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371907012"
     variation       907
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183715072"
     variation       927
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76136794"
     variation       932
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375247098"
     variation       942
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146035561"
     variation       961
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140270120"
     variation       1011
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145354751"
     exon            1034..1132
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1068
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369231964"
     variation       1073
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77038741"
     variation       1099
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186474420"
     exon            1133..3452
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1153
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371774895"
     variation       1164
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375761169"
     variation       1178
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143463721"
     variation       1193
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7131283"
     variation       1194
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148391374"
     variation       1241
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369024994"
     variation       1247
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142563385"
     variation       1257
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373780418"
     variation       1265
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116626186"
     variation       1270
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140195795"
     variation       1296
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142269991"
     variation       1302
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147713621"
     variation       1303
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142667482"
     variation       1314
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370208539"
     variation       1352
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373858678"
     variation       1355
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150268605"
     variation       1412
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117801657"
     variation       1415
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149338262"
     variation       1451
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187868937"
     variation       1497
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150868984"
     variation       1513
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193025815"
     variation       1514
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368158780"
     variation       1515
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375278465"
     variation       1520
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114064661"
     variation       1536
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138285006"
     variation       1541
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142839945"
     variation       1561
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369608879"
     variation       1572
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185708225"
     variation       1609
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201469306"
     variation       1615
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114663860"
     variation       1624
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376669252"
     variation       1635
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139364741"
     variation       1641
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149681158"
     variation       1661
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150784858"
     variation       1711
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370940283"
     variation       1740
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145539034"
     variation       1760
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149868650"
     variation       1771
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144883718"
     variation       1808
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140428922"
     variation       1844
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144301602"
     variation       1878
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116345276"
     variation       1900
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112103602"
     variation       1932
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369619070"
     variation       1960
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373220783"
     variation       1972..1973
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35183103"
     variation       2016
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3802959"
     variation       2047
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143398166"
     variation       2058
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139435636"
     variation       2065
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145054362"
     variation       2103
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140456628"
     variation       2117
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376488191"
     variation       2155
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150409796"
     variation       2160
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74837900"
     variation       2176
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142892172"
     variation       2191
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145051590"
     variation       2208
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199805024"
     variation       2232
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199505839"
     variation       2235
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374402343"
     variation       2246
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201227484"
     variation       2269
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142235413"
     variation       2301
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113290465"
     variation       2305
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80173276"
     variation       2306
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144635507"
     variation       2319
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372468983"
     variation       2341
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370935983"
     variation       2391
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200738251"
     variation       2392
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148489703"
     variation       2399
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897716"
     variation       2414
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3825020"
     variation       2440
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374558627"
     variation       2493
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116224124"
     variation       2500
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73481226"
     variation       2510
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200543306"
     variation       2514
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144309625"
     variation       2515
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726394"
     variation       2522
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200307761"
     variation       2529
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3016727"
     variation       2542
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147367847"
     variation       2543
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936913"
     variation       2558
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368186934"
     variation       2560
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146179294"
     variation       2572
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370794980"
     variation       2581
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375353153"
     variation       2601
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145801550"
     variation       2625
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368014397"
     variation       2627
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149015522"
     variation       2685
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142968938"
     variation       2690
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151183005"
     variation       2723
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181547264"
     variation       2831
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77025492"
     variation       2941
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184474834"
     variation       3041
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375774697"
     variation       3063
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443243"
     STS             3093..3286
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="RH17567"
                     /db_xref="UniSTS:70207"
     variation       3152
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78731118"
     variation       3231
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375396734"
     STS             3249..3348
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="SGC34191"
                     /db_xref="UniSTS:21339"
     variation       3267
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75538311"
     variation       3289
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138237921"
     variation       3297
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188971082"
     variation       3388..3389
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="aacac"
                     /db_xref="dbSNP:140068962"
     variation       3429
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181921480"
ORIGIN      
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttatttttattcttacaggatacctcacagtaaccgataagaaatcaaaacttctgggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattggaattttgttaatcttactgatcatcagcatagcagagctcagcatctctgtgactattgcatcctttagaagcaagtgctggacacagtcagatgaggttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.