GGRNA Home | Help | Advanced search

2025-05-09 18:58:31, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001079692            3302 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
            (MS4A14), transcript variant 2, mRNA.
ACCESSION   NM_001079692
VERSION     NM_001079692.2  GI:387849345
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3302)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP003127.2 and AY094611.1.
            On May 17, 2012 this sequence version replaced gi:119226219.
            
            Transcript Variant: This variant (2) has multiple coding region
            differences, compared to variant 4, which results in a shorter
            protein (isoform 2), compared to isoform 4.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY094611.1, AY584610.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-472               AP003127.2         99935-100406
            473-1042            AY094611.1         57-626
            1043-3302           AP003127.2         119418-121677
FEATURES             Location/Qualifiers
     source          1..3302
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q12.2"
     gene            1..3302
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="membrane-spanning 4-domains, subfamily A, member
                     14"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
     exon            1..703
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       31
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186234557"
     variation       39
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7929046"
     variation       40
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190992915"
     variation       51..52
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:377307026"
     variation       102
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76333679"
     variation       110
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143358541"
     variation       149
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3816270"
     variation       223
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76174817"
     variation       281
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180800488"
     variation       296
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185942516"
     variation       379
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141665394"
     misc_feature    410..412
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="upstream in-frame stop codon"
     variation       421
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112785513"
     variation       427
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375045470"
     variation       432
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190864604"
     variation       472
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6591579"
     variation       517
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368431455"
     variation       545
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367878785"
     variation       560
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592380"
     CDS             566..2554
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="isoform 2 is encoded by transcript variant 2;
                     membrane-spanning 4-domains, subfamily A, member 16;
                     testes development-related NYD-SP21; MS4A13 protein;
                     testis development protein NYD-SP21"
                     /codon_start=1
                     /product="membrane-spanning 4-domains subfamily A member
                     14 isoform 2"
                     /protein_id="NP_001073160.1"
                     /db_xref="GI:119226220"
                     /db_xref="CCDS:CCDS41652.1"
                     /db_xref="GeneID:84689"
                     /db_xref="HGNC:30706"
                     /translation="
MESTSQDRRATHVITIKPNETVLTAFPYRPHSSLLDFLKGEPRVLGATQILLALIIVGFGTIFALNYIGFSQRLPLVVLTGYPFWGALIGQGVTGMNVISSLVAITGITFTILSYRHQDKYCQMPSFEEICVFSRTLFIVLFFLPSDVTQNSEQPAPEENDQLQFVLQEEFSSDDSTTNAQSVIFGGYAFFKLTLSRSPLVSQPGNKGREFVPDEQKQSILPSPKFSEEEIEPLPPTLEKKPSENMSIQLDSTFKQMKDEDLQSAIVQPSQMQTKLLQDQAASLQVFPSHSALKLEDISPEDLPSQALPVEGLSEQTMPSKSTSSHVKQSSNLTANDLPPQGILSQDTSSQDMLFHDMTSQDMQSLDMLSQDTPSHAMPPQDIPSQDMLSQALSAHAILPEASTSHIVQFPEIQHLLQQPPDLQPENTEPQNQQILQMSYQDIRSEVMEETKEWKSEEELHRRKSSRRHSLNQQTKALQYLRRHSLDVQAKGQKSSKRHSLDQQSKGWQSPKQKSLDQQIKDWLSPKRHSVDKQAQLNQTKEQLPDQQAEDQQAKGEQYPEGQSKDGQVKDQQTDKEQNSKKQTQDQQTEDQPAQEKKSPKGQFQNVQAEGQQAQVEKVPKLLCQDSESQIQQYQFWQFHKGNLQAGQPRTVNLLAKNPLTG
"
     misc_feature    695..>973
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /note="CD20-like family; Region: CD20; pfam04103"
                     /db_xref="CDD:202888"
     variation       569
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201462421"
     variation       577
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375301622"
     variation       589
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140226757"
     variation       601
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200092161"
     variation       602
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371634910"
     variation       640
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150323558"
     variation       653
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200017443"
     variation       701
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138895874"
     exon            704..832
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       709
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141700245"
     variation       731
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:72514098"
     variation       732..733
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:3217518"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74733740"
     variation       732
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:77630012"
     variation       747
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147119308"
     variation       769
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138517611"
     variation       770
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368053345"
     variation       771
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144076317"
     variation       794
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369576834"
     variation       796
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144248317"
     variation       802
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2197234"
     variation       810
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372708908"
     variation       815
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148297999"
     variation       827
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375255532"
     variation       831
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141490187"
     exon            833..982
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       833
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375760675"
     variation       834
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202236686"
     variation       846
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146613208"
     variation       847
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371907012"
     variation       856
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183715072"
     variation       876
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76136794"
     variation       881
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375247098"
     variation       891
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146035561"
     variation       910
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140270120"
     variation       960
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145354751"
     exon            983..3302
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /inference="alignment:Splign:1.39.8"
     variation       1003
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371774895"
     variation       1014
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375761169"
     variation       1028
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143463721"
     variation       1043
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7131283"
     variation       1044
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148391374"
     variation       1091
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369024994"
     variation       1097
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142563385"
     variation       1107
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373780418"
     variation       1115
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116626186"
     variation       1120
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140195795"
     variation       1146
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142269991"
     variation       1152
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147713621"
     variation       1153
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142667482"
     variation       1164
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370208539"
     variation       1202
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373858678"
     variation       1205
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150268605"
     variation       1262
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117801657"
     variation       1265
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149338262"
     variation       1301
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187868937"
     variation       1347
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150868984"
     variation       1363
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193025815"
     variation       1364
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368158780"
     variation       1365
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375278465"
     variation       1370
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114064661"
     variation       1386
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138285006"
     variation       1391
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142839945"
     variation       1411
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369608879"
     variation       1422
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185708225"
     variation       1459
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201469306"
     variation       1465
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114663860"
     variation       1474
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376669252"
     variation       1485
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139364741"
     variation       1491
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149681158"
     variation       1511
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150784858"
     variation       1561
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370940283"
     variation       1590
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145539034"
     variation       1610
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149868650"
     variation       1621
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144883718"
     variation       1658
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140428922"
     variation       1694
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144301602"
     variation       1728
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116345276"
     variation       1750
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112103602"
     variation       1782
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369619070"
     variation       1810
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373220783"
     variation       1822..1823
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35183103"
     variation       1866
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3802959"
     variation       1897
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143398166"
     variation       1908
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139435636"
     variation       1915
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145054362"
     variation       1953
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140456628"
     variation       1967
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376488191"
     variation       2005
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150409796"
     variation       2010
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74837900"
     variation       2026
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142892172"
     variation       2041
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145051590"
     variation       2058
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199805024"
     variation       2082
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199505839"
     variation       2085
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374402343"
     variation       2096
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201227484"
     variation       2119
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142235413"
     variation       2151
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113290465"
     variation       2155
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80173276"
     variation       2156
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144635507"
     variation       2169
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372468983"
     variation       2191
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370935983"
     variation       2241
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200738251"
     variation       2242
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148489703"
     variation       2249
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375897716"
     variation       2264
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3825020"
     variation       2290
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374558627"
     variation       2343
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116224124"
     variation       2350
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:73481226"
     variation       2360
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200543306"
     variation       2364
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144309625"
     variation       2365
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726394"
     variation       2372
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200307761"
     variation       2379
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3016727"
     variation       2392
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147367847"
     variation       2393
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936913"
     variation       2408
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368186934"
     variation       2410
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146179294"
     variation       2422
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370794980"
     variation       2431
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375353153"
     variation       2451
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145801550"
     variation       2475
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368014397"
     variation       2477
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149015522"
     variation       2535
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142968938"
     variation       2540
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151183005"
     variation       2573
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181547264"
     variation       2681
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77025492"
     variation       2791
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:184474834"
     variation       2891
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375774697"
     variation       2913
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443243"
     STS             2943..3136
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="RH17567"
                     /db_xref="UniSTS:70207"
     variation       3002
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78731118"
     variation       3081
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375396734"
     STS             3099..3198
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /standard_name="SGC34191"
                     /db_xref="UniSTS:21339"
     variation       3117
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75538311"
     variation       3139
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138237921"
     variation       3147
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188971082"
     variation       3238..3239
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace=""
                     /replace="aacac"
                     /db_xref="dbSNP:140068962"
     variation       3279
                     /gene="MS4A14"
                     /gene_synonym="MS4A16; NYD-SP21"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181921480"
ORIGIN      
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttattggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.