Home |
Help |
Advanced search
2025-05-09 18:27:02, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005577 6489 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens lipoprotein, Lp(a) (LPA), mRNA.
ACCESSION NM_005577 XM_926329 XM_941794
VERSION NM_005577.2 GI:116292749
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 6489)
AUTHORS Kamstrup,P.R., Tybjaerg-Hansen,A. and Nordestgaard,B.G.
TITLE Extreme lipoprotein(a) levels and improved cardiovascular risk
prediction
JOURNAL J. Am. Coll. Cardiol. 61 (11), 1146-1156 (2013)
PUBMED 23375930
REMARK GeneRIF: Extreme lipoprotein(a) levels or corresponding LPA
KIV-2/rs10455872 risk genotypes substantially improved MI and CHD
risk prediction
REFERENCE 2 (bases 1 to 6489)
AUTHORS Thanassoulis,G., Campbell,C.Y., Owens,D.S., Smith,J.G., Smith,A.V.,
Peloso,G.M., Kerr,K.F., Pechlivanis,S., Budoff,M.J., Harris,T.B.,
Malhotra,R., O'Brien,K.D., Kamstrup,P.R., Nordestgaard,B.G.,
Tybjaerg-Hansen,A., Allison,M.A., Aspelund,T., Criqui,M.H.,
Heckbert,S.R., Hwang,S.J., Liu,Y., Sjogren,M., van der Pals,J.,
Kalsch,H., Muhleisen,T.W., Nothen,M.M., Cupples,L.A., Caslake,M.,
Di Angelantonio,E., Danesh,J., Rotter,J.I., Sigurdsson,S., Wong,Q.,
Erbel,R., Kathiresan,S., Melander,O., Gudnason,V., O'Donnell,C.J.
and Post,W.S.
CONSRTM CHARGE Extracoronary Calcium Working Group
TITLE Genetic associations with valvular calcification and aortic
stenosis
JOURNAL N. Engl. J. Med. 368 (6), 503-512 (2013)
PUBMED 23388002
REMARK GeneRIF: Genetic variation in the LPA locus, mediated by Lp(a)
levels, is associated with aortic-valve calcification across
multiple ethnic groups and with incident clinical aortic stenosis.
REFERENCE 3 (bases 1 to 6489)
AUTHORS Enkhmaa,B., Anuurad,E., Zhang,W., Abbuthalha,A., Li,X.D.,
Dotterweich,W., Pollard,R.B., Asmuth,D.M. and Berglund,L.
TITLE HIV disease activity as a modulator of lipoprotein(a) and
allele-specific apolipoprotein(a) levels
JOURNAL Arterioscler. Thromb. Vasc. Biol. 33 (2), 387-392 (2013)
PUBMED 23202367
REMARK GeneRIF: Report HIV disease activity modulates lipoprotein(a) and
allele-specific apolipoprotein(a) levels and cardiovascular risk.
REFERENCE 4 (bases 1 to 6489)
AUTHORS Chu,A.Y., Guilianini,F., Grallert,H., Dupuis,J., Ballantyne,C.M.,
Barratt,B.J., Nyberg,F., Chasman,D.I. and Ridker,P.M.
TITLE Genome-wide association study evaluating lipoprotein-associated
phospholipase A2 mass and activity at baseline and after
rosuvastatin therapy
JOURNAL Circ Cardiovasc Genet 5 (6), 676-685 (2012)
PUBMED 23118302
REFERENCE 5 (bases 1 to 6489)
AUTHORS Malek,F., Dvorak,J., Svitil,J., Skalnikova,V., Mates,M.,
Kmonicek,P., Formanek,P., Aschermann,O., Kopriva,K. and Neuzil,P.
TITLE Correlation of lipoprotein (a) concentration with the extent of
coronary artery disease in patients on lipid lowering therapy
JOURNAL Neuro Endocrinol. Lett. 33 (SUPPL 2), 55-59 (2012)
PUBMED 23183511
REMARK GeneRIF: Only Lp(a) levels correlated with the extent of coronary
artery disease as assessed with coronary angiography in patients
treated with lipid lowering therapy.
REFERENCE 6 (bases 1 to 6489)
AUTHORS Scanu,A.M., Pfaffinger,D., Lee,J.C. and Hinman,J.
TITLE A single point mutation (Trp72-->Arg) in human apo(a) kringle 4-37
associated with a lysine binding defect in Lp(a)
JOURNAL Biochim. Biophys. Acta 1227 (1-2), 41-45 (1994)
PUBMED 7918682
REFERENCE 7 (bases 1 to 6489)
AUTHORS Salonen,E.M., Jauhiainen,M., Zardi,L., Vaheri,A. and Ehnholm,C.
TITLE Lipoprotein(a) binds to fibronectin and has serine proteinase
activity capable of cleaving it
JOURNAL EMBO J. 8 (13), 4035-4040 (1989)
PUBMED 2531657
REFERENCE 8 (bases 1 to 6489)
AUTHORS Utermann,G.
TITLE The mysteries of lipoprotein(a)
JOURNAL Science 246 (4932), 904-910 (1989)
PUBMED 2530631
REMARK Review article
REFERENCE 9 (bases 1 to 6489)
AUTHORS Frank,S.L., Klisak,I., Sparkes,R.S., Mohandas,T., Tomlinson,J.E.,
McLean,J.W., Lawn,R.M. and Lusis,A.J.
TITLE The apolipoprotein(a) gene resides on human chromosome 6q26-27, in
close proximity to the homologous gene for plasminogen
JOURNAL Hum. Genet. 79 (4), 352-356 (1988)
PUBMED 3410459
REFERENCE 10 (bases 1 to 6489)
AUTHORS McLean,J.W., Tomlinson,J.E., Kuang,W.J., Eaton,D.L., Chen,E.Y.,
Fless,G.M., Scanu,A.M. and Lawn,R.M.
TITLE cDNA sequence of human apolipoprotein(a) is homologous to
plasminogen
JOURNAL Nature 330 (6144), 132-137 (1987)
PUBMED 3670400
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL109933.25 and AL596089.19.
This sequence is a reference standard in the RefSeqGene project.
On Oct 20, 2006 this sequence version replaced gi:5031884.
Summary: The protein encoded by this gene is a serine proteinase
that inhibits the activity of tissue-type plasminogen activator I.
The encoded protein constitutes a substantial portion of
lipoprotein(a) and is proteolytically cleaved, resulting in
fragments that attach to atherosclerotic lesions and promote
thrombogenesis. Elevated plasma levels of this protein are linked
to atherosclerosis. Depending on the individual, the encoded
protein contains 2-43 copies of kringle-type domains. The allele
represented here contains 15 copies of the kringle-type repeats and
corresponds to that found in the reference genome sequence.
[provided by RefSeq, Dec 2009].
Sequence Note: This gene is highly polymorphic in length and number
of exons due to variation in the number of kringle IV-2 repeats
which vary from 2-43 copies among individuals. This RefSeq record
was created from the reference genome assembly based on the exon
representation found in DQ452068.1 whose sequence is consistent
with the reference genome sequence, and includes 15 copies of the
kringle IV-2 repeats.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: mixed/partial sample support ERS025082, ERS025084
[ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-75 AL109933.25 16267-16341 c
76-169 AL109933.25 14132-14225 c
170-329 AL109933.25 304-463 c
330-511 AL596089.19 129931-130112 c
512-671 AL596089.19 128564-128723 c
672-853 AL596089.19 124384-124565 c
854-1013 AL596089.19 123017-123176 c
1014-1195 AL596089.19 118840-119021 c
1196-1355 AL596089.19 117470-117629 c
1356-1537 AL596089.19 113291-113472 c
1538-1697 AL596089.19 111924-112083 c
1698-1879 AL596089.19 107747-107928 c
1880-2039 AL596089.19 106380-106539 c
2040-2221 AL596089.19 102201-102382 c
2222-2381 AL596089.19 100834-100993 c
2382-2563 AL596089.19 96649-96830 c
2564-2723 AL596089.19 95279-95438 c
2724-2905 AL596089.19 90194-90375 c
2906-3065 AL596089.19 88763-88922 c
3066-3247 AL596089.19 84634-84815 c
3248-3407 AL596089.19 83217-83376 c
3408-3589 AL596089.19 79071-79252 c
3590-3749 AL596089.19 77675-77834 c
3750-3907 AL596089.19 74661-74818 c
3908-4067 AL596089.19 73270-73429 c
4068-4249 AL596089.19 70166-70347 c
4250-4409 AL596089.19 68763-68922 c
4410-4591 AL596089.19 62240-62421 c
4592-4751 AL596089.19 60853-61012 c
4752-4933 AL596089.19 41107-41288 c
4934-5093 AL596089.19 39742-39901 c
5094-5275 AL596089.19 32195-32376 c
5276-5424 AL596089.19 31506-31654 c
5425-5518 AL596089.19 29157-29250 c
5519-5639 AL596089.19 26405-26525 c
5640-5714 AL596089.19 24824-24898 c
5715-5855 AL596089.19 23760-23900 c
5856-5962 AL596089.19 21572-21678 c
5963-6081 AL596089.19 16248-16366 c
6082-6489 AL596089.19 15200-15607 c
FEATURES Location/Qualifiers
source 1..6489
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6q26"
gene 1..6489
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="lipoprotein, Lp(a)"
/db_xref="GeneID:4018"
/db_xref="HGNC:6667"
/db_xref="MIM:152200"
exon 1..75
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 73..75
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="upstream in-frame stop codon"
exon 76..169
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 89
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="c"
/db_xref="dbSNP:1623955"
variation 100
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="g"
/db_xref="dbSNP:1800769"
CDS 121..6243
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/EC_number="3.4.21.-"
/note="antiangiogenic AK38 protein; apolipoprotein(a);
lp(a); apo(a)"
/codon_start=1
/product="apolipoprotein(a) precursor"
/protein_id="NP_005568.2"
/db_xref="GI:116292750"
/db_xref="CCDS:CCDS43523.1"
/db_xref="GeneID:4018"
/db_xref="HGNC:6667"
/db_xref="MIM:152200"
/translation="
MEHKEVVLLLLLFLKSAAPEQSHVVQDCYHGDGQSYRGTYSTTVTGRTCQAWSSMTPHQHNRTTENYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDAVAAPYCYTRDPGVRWEYCNLTQCSDAEGTAVAPPTVTPVPSLEAPSEQAPTEQRPGVQECYHGNGQSYRGTYSTTVTGRTCQAWSSMTPHSHSRTPEYYPNAGLIMNYCRNPDPVAAPYCYTRDPSVRWEYCNLTQCSDAEGTAVAPPTITPIPSLEAPSEQAPTEQRPGVQECYHGNGQSYQGTYFITVTGRTCQAWSSMTPHSHSRTPAYYPNAGLIKNYCRNPDPVAAPWCYTTDPSVRWEYCNLTRCSDAEWTAFVPPNVILAPSLEAFFEQALTEETPGVQDCYYHYGQSYRGTYSTTVTGRTCQAWSSMTPHQHSRTPENYPNAGLTRNYCRNPDAEIRPWCYTMDPSVRWEYCNLTQCLVTESSVLATLTVVPDPSTEASSEEAPTEQSPGVQDCYHGDGQSYRGSFSTTVTGRTCQSWSSMTPHWHQRTTEYYPNGGLTRNYCRNPDAEISPWCYTMDPNVRWEYCNLTQCPVTESSVLATSTAVSEQAPTEQSPTVQDCYHGDGQSYRGSFSTTVTGRTCQSWSSMTPHWHQRTTEYYPNGGLTRNYCRNPDAEIRPWCYTMDPSVRWEYCNLTQCPVMESTLLTTPTVVPVPSTELPSEEAPTENSTGVQDCYRGDGQSYRGTLSTTITGRTCQSWSSMTPHWHRRIPLYYPNAGLTRNYCRNPDAEIRPWCYTMDPSVRWEYCNLTRCPVTESSVLTTPTVAPVPSTEAPSEQAPPEKSPVVQDCYHGDGRSYRGISSTTVTGRTCQSWSSMIPHWHQRTPENYPNAGLTENYCRNPDSGKQPWCYTTDPCVRWEYCNLTQCSETESGVLETPTVVPVPSMEAHSEAAPTEQTPVVRQCYHGNGQSYRGTFSTTVTGRTCQSWSSMTPHRHQRTPENYPNDGLTMNYCRNPDADTGPWCFTMDPSIRWEYCNLTRCSDTEGTVVAPPTVIQVPSLGPPSEQDCMFGNGKGYRGKKATTVTGTPCQEWAAQEPHRHSTFIPGTNKWAGLEKNYCRNPDGDINGPWCYTMNPRKLFDYCDIPLCASSSFDCGKPQVEPKKCPGSIVGGCVAHPHSWPWQVSLRTRFGKHFCGGTLISPEWVLTAAHCLKKSSRPSSYKVILGAHQEVNLESHVQEIEVSRLFLEPTQADIALLKLSRPAVITDKVMPACLPSPDYMVTARTECYITGWGETQGTFGTGLLKEAQLLVIENEVCNHYKYICAEHLARGTDSCQGDSGGPLVCFEKDKYILQGVTSWGLGCARPNKPGVYARVSRFVTWIEGMMRNN
"
sig_peptide 121..177
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 178..6240
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/product="apolipoprotein(a)"
misc_feature 196..438
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 229..231
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(274..276,304..306,379..381,385..387,409..411)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 538..780
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 571..573
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(616..618,646..648,721..723,727..729,751..753)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 880..1122
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 913..915
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(958..960,988..990,1063..1065,1069..1071,1093..1095)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 1222..1464
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 1255..1257
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(1300..1302,1330..1332,1405..1407,1411..1413,
1435..1437)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 1564..1806
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 1597..1599
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(1642..1644,1672..1674,1747..1749,1753..1755,
1777..1779)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 1906..2148
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 1939..1941
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(1984..1986,2014..2016,2089..2091,2095..2097,
2119..2121)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 2248..2490
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 2281..2283
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(2326..2328,2356..2358,2431..2433,2437..2439,
2461..2463)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 2590..2832
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 2623..2625
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(2668..2670,2698..2700,2773..2775,2779..2781,
2803..2805)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 2932..3174
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 2965..2967
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(3010..3012,3040..3042,3115..3117,3121..3123,
3145..3147)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 3205..3207
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:03027"
misc_feature 3211..3213
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00553"
misc_feature 3211..3213
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00554"
misc_feature 3274..3513
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 3307..3309
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(3352..3354,3382..3384,3457..3459,3463..3465,
3487..3489)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 3616..3858
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 3649..3651
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(3694..3696,3724..3726,3799..3801,3805..3807,
3829..3831)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 3934..4176
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 3967..3969
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(4012..4014,4042..4044,4117..4119,4123..4125,
4147..4149)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 4189..4191
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00554"
misc_feature 4276..4518
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 4309..4311
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(4354..4356,4384..4386,4459..4461,4465..4467,
4489..4491)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 4618..4860
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 4651..4653
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(4696..4698,4726..4728,4801..4803,4807..4809,
4831..4833)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 4960..5202
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 4993..4995
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(5038..5040,5068..5070,5143..5145,5149..5151,
5173..5175)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 5239..5241
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:00554"
misc_feature 5269..5520
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Kringle domain; Kringle domains are believed to
play a role in binding mediators, such as peptides, other
proteins, membranes, or phospholipids. They are autonomous
structural domains, found in a varying number of copies,
in blood clotting and...; Region: KR; cd00108"
/db_xref="CDD:29008"
misc_feature 5305..5307
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="putative domain interaction site; other site"
/db_xref="CDD:29008"
misc_feature order(5350..5352,5383..5385,5461..5463,5467..5469,
5491..5493)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="ligand binding site [chemical binding]; other site"
/db_xref="CDD:29008"
misc_feature 5578..6222
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Trypsin-like serine protease; Many of these are
synthesized as inactive precursor zymogens that are
cleaved during limited proteolysis to generate their
active forms. Alignment contains also inactive enzymes
that have substitutions of the catalytic triad...; Region:
Tryp_SPc; cd00190"
/db_xref="CDD:29152"
misc_feature 5578..5580
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="cleavage site"
/db_xref="CDD:29152"
misc_feature order(5701..5703,5830..5832,6088..6090)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="active site"
/db_xref="CDD:29152"
misc_feature order(6070..6072,6145..6147,6151..6153)
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="substrate binding sites [chemical binding]; other
site"
/db_xref="CDD:29152"
variation 160
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:934266"
exon 170..329
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 176..510
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 330..511
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 511..852
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 512..671
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 672..853
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 853..1194
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 854..1013
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 1014..1195
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 1195..1536
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 1196..1355
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 1356..1537
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 1537..1878
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 1538..1697
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 1698..1879
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 1879..2220
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 1880..2039
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 2040..2221
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 2221..2562
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 2222..2381
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 2382..2563
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 2563..2904
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 2564..2723
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 2724..2905
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 2794
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="g"
/db_xref="dbSNP:41269892"
misc_feature 2905..3246
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 2906..3065
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 3066..3247
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 3247..3588
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 3248..3407
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 3408..3589
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 3589..3906
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="There is an internal 24 nt deletion, so the size of
this repeat is smaller than 342 nts; Region: kringle IV-2
repeat"
exon 3590..3749
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 3750..3907
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 3907..4248
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 3908..4067
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 4013
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="g"
/db_xref="dbSNP:41272074"
exon 4068..4249
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 4167
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="g"
/db_xref="dbSNP:41272102"
misc_feature 4249..4590
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 4250..4409
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 4315
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="c"
/db_xref="dbSNP:41272110"
variation 4382
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="g"
/db_xref="dbSNP:41272112"
exon 4410..4591
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
misc_feature 4591..4932
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 4592..4751
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 4689
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:41264288"
exon 4752..4933
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 4876
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="g"
/db_xref="dbSNP:41264306"
variation 4913
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:41264308"
misc_feature 4933..5274
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/note="Region: kringle IV-2 repeat"
exon 4934..5093
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 5094..5275
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
STS 5130..5260
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/standard_name="GDB:595276"
/db_xref="UniSTS:158018"
variation 5156
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:1801693"
variation 5246
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="t"
/db_xref="dbSNP:41264338"
exon 5276..5424
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 5277
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:41264848"
variation 5370
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:41264850"
exon 5425..5518
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 5448
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="c"
/replace="t"
/db_xref="dbSNP:41264854"
variation 5449
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="g"
/db_xref="dbSNP:41264856"
exon 5519..5639
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
variation 5585
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:41265936"
exon 5640..5714
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 5715..5855
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 5856..5962
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 5963..6081
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
exon 6082..6489
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/inference="alignment:Splign:1.39.8"
STS 6245..6375
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/standard_name="STS-X06290"
/db_xref="UniSTS:72928"
STS 6247..6489
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/standard_name="D6S1951"
/db_xref="UniSTS:43503"
variation 6383
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
/replace="g"
/replace="t"
/db_xref="dbSNP:41266381"
polyA_signal 6462..6467
/gene="LPA"
/gene_synonym="AK38; APOA; LP"
ORIGIN
aggtacctttggggctggctttctcaaggaagcccagctccctgtgattgagaatgaagtgtgcaatcgctatgactgggattgggacacactttctgggcactgctggccagtcccaaaatggaacataaggaagtggttcttctacttcttttatttctgaaatcagcagcacctgagcaaagccatgtggtccaggattgctaccatggtgatggacagagttatcgaggcacgtactccaccactgtcacaggaaggacctgccaagcttggtcatctatgacaccacatcaacataataggaccacagaaaactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcaaaggcctggggtgcaggagtgctaccatggtaatggacagagttatcgaggcacatactccaccactgtcacaggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcaaaggcctggggtgcaggagtgctaccatggtaatggacagagttatcgaggcacatactccaccactgtcacaggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcagaggcctggggtgcaggagtgctaccacggtaatggacagagttatcgaggcacatactccaccactgtcactggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcaaaggcctggggtgcaggagtgctaccatggtaatggacagagttatcgaggcacatactccaccactgtcacaggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcaaaggcctggggtgcaggagtgctaccatggtaatggacagagttatcgaggcacatactccaccactgtcacaggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcaaaggcctggggtgcaggagtgctaccatggtaatggacagagttatcgaggcacatactccaccactgtcacaggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatgctgtggcagctccttattgttatacgagggatcccggtgtcaggtgggagtactgcaacctgacgcaatgctcagacgcagaagggactgccgtcgcgcctccgactgttaccccggttccaagcctagaggctccttccgaacaagcaccgactgagcagaggcctggggtgcaggagtgctaccacggtaatggacagagttatcgaggcacatactccaccactgtcactggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagaatactacccaaatgctggcttgatcatgaactactgcaggaatccagatcctgtggcagccccttattgttatacgagggatcccagtgtcaggtgggagtactgcaacctgacacaatgctcagacgcagaagggactgccgtcgcgcctccaactattaccccgattccaagcctagaggctccttctgaacaagcaccaactgagcaaaggcctggggtgcaggagtgctaccacggaaatggacagagttatcaaggcacatacttcattactgtcacaggaagaacctgccaagcttggtcatctatgacaccacactcgcatagtcggaccccagcatactacccaaatgctggcttgatcaagaactactgccgaaatccagatcctgtggcagccccttggtgttatacaacagatcccagtgtcaggtgggagtactgcaacctgacacgatgctcagatgcagaatggactgccttcgtccctccgaatgttattctggctccaagcctagaggctttttttgaacaagcactgactgaggaaacccccggggtacaggactgctactaccattatggacagagttaccgaggcacatactccaccactgtcacaggaagaacttgccaagcttggtcatctatgacaccacaccagcatagtcggaccccagaaaactacccaaatgctggcctgaccaggaactactgcaggaatccagatgctgagattcgcccttggtgttacaccatggatcccagtgtcaggtgggagtactgcaacctgacacaatgcctggtgacagaatcaagtgtccttgcaactctcacggtggtcccagatccaagcacagaggcttcttctgaagaagcaccaacggagcaaagccccggggtccaggattgctaccatggtgatggacagagttatcgaggctcattctctaccactgtcacaggaaggacatgtcagtcttggtcctctatgacaccacactggcatcagaggacaacagaatattatccaaatggtggcctgaccaggaactactgcaggaatccagatgctgagattagtccttggtgttataccatggatcccaatgtcagatgggagtactgcaacctgacacaatgtccagtgacagaatcaagtgtccttgcgacgtccacggctgtttctgaacaagcaccaacggagcaaagccccacagtccaggactgctaccatggtgatggacagagttatcgaggctcattctccaccactgttacaggaaggacatgtcagtcttggtcctctatgacaccacactggcatcagagaaccacagaatactacccaaatggtggcctgaccaggaactactgcaggaatccagatgctgagattcgcccttggtgttataccatggatcccagtgtcagatgggagtactgcaacctgacgcaatgtccagtgatggaatcaactctcctcacaactcccacggtggtcccagttccaagcacagagcttccttctgaagaagcaccaactgaaaacagcactggggtccaggactgctaccgaggtgatggacagagttatcgaggcacactctccaccactatcacaggaagaacatgtcagtcttggtcgtctatgacaccacattggcatcggaggatcccattatactatccaaatgctggcctgaccaggaactactgcaggaatccagatgctgagattcgcccttggtgttacaccatggatcccagtgtcaggtgggagtactgcaacctgacacgatgtccagtgacagaatcgagtgtcctcacaactcccacagtggccccggttccaagcacagaggctccttctgaacaagcaccacctgagaaaagccctgtggtccaggattgctaccatggtgatggacggagttatcgaggcatatcctccaccactgtcacaggaaggacctgtcaatcttggtcatctatgataccacactggcatcagaggaccccagaaaactacccaaatgctggcctgaccgagaactactgcaggaatccagattctgggaaacaaccctggtgttacacaaccgatccgtgtgtgaggtgggagtactgcaatctgacacaatgctcagaaacagaatcaggtgtcctagagactcccactgttgttccagttccaagcatggaggctcattctgaagcagcaccaactgagcaaacccctgtggtccggcagtgctaccatggtaatggccagagttatcgaggcacattctccaccactgtcacaggaaggacatgtcaatcttggtcatccatgacaccacaccggcatcagaggaccccagaaaactacccaaatgatggcctgacaatgaactactgcaggaatccagatgccgatacaggcccttggtgttttaccatggaccccagcatcaggtgggagtactgcaacctgacgcgatgctcagacacagaagggactgtggtcgctcctccgactgtcatccaggttccaagcctagggcctccttctgaacaagactgtatgtttgggaatgggaaaggataccggggcaagaaggcaaccactgttactgggacgccatgccaggaatgggctgcccaggagccccatagacacagcacgttcattccagggacaaataaatgggcaggtctggaaaaaaattactgccgtaaccctgatggtgacatcaatggtccctggtgctacacaatgaatccaagaaaactttttgactactgtgatatccctctctgtgcatcctcttcatttgattgtgggaagcctcaagtggagccgaagaaatgtcctggaagcattgtaggggggtgtgtggcccacccacattcctggccctggcaagtcagtctcagaacaaggtttggaaagcacttctgtggaggcaccttaatatccccagagtgggtgctgactgctgctcactgcttgaagaagtcctcaaggccttcatcctacaaggtcatcctgggtgcacaccaagaagtgaacctcgaatctcatgttcaggaaatagaagtgtctaggctgttcttggagcccacacaagcagatattgccttgctaaagctaagcaggcctgccgtcatcactgacaaagtaatgccagcttgtctgccatccccagactacatggtcaccgccaggactgaatgttacatcactggctggggagaaacccaaggtacctttgggactggccttctcaaggaagcccagctccttgttattgagaatgaagtgtgcaatcactataagtatatttgtgctgagcatttggccagaggcactgacagttgccagggtgacagtggagggcctctggtttgcttcgagaaggacaaatacattttacaaggagtcacttcttggggtcttggctgtgcacgccccaataagcctggtgtctatgctcgtgtttcaaggtttgttacttggattgagggaatgatgagaaataattaattggacgggagacagagtgaagcatcaacctacttagaagctgaaacgtgggtaaggatttagcatgctggaaataatagacagcaatcaaacgaagacactgttcccagctaccagctatgccaaaccttggcatttttggtatttttgtgtataagcttttaaggtctgactgacaaattctgtattaaggtgtcatagctatgacatttgttaaaaataaactctgcacttattttgatttga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:4018 -> Molecular function: GO:0001968 [fibronectin binding] evidence: IPI
GeneID:4018 -> Molecular function: GO:0004252 [serine-type endopeptidase activity] evidence: IDA
GeneID:4018 -> Molecular function: GO:0004866 [endopeptidase inhibitor activity] evidence: TAS
GeneID:4018 -> Molecular function: GO:0008201 [heparin binding] evidence: NAS
GeneID:4018 -> Molecular function: GO:0034185 [apolipoprotein binding] evidence: IPI
GeneID:4018 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
GeneID:4018 -> Biological process: GO:0006629 [lipid metabolic process] evidence: NAS
GeneID:4018 -> Biological process: GO:0006869 [lipid transport] evidence: IEA
GeneID:4018 -> Biological process: GO:0006898 [receptor-mediated endocytosis] evidence: TAS
GeneID:4018 -> Biological process: GO:0008015 [blood circulation] evidence: TAS
GeneID:4018 -> Biological process: GO:0010951 [negative regulation of endopeptidase activity] evidence: TAS
GeneID:4018 -> Biological process: GO:0042157 [lipoprotein metabolic process] evidence: TAS
GeneID:4018 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:4018 -> Cellular component: GO:0005576 [extracellular region] evidence: NAS
GeneID:4018 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
GeneID:4018 -> Cellular component: GO:0034358 [plasma lipoprotein particle] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_005568 -> EC 3.4.21.-
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.