GGRNA Home | Help | Advanced search

2025-06-13 01:14:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_024438               1988 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens actin, gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA.
ACCESSION   NR_024438 XR_018995 XR_038169
VERSION     NR_024438.2  GI:219802466
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1988)
  AUTHORS   Samuelson,L.C., Wiebauer,K., Snow,C.M. and Meisler,M.H.
  TITLE     Retroviral and pseudogene insertion sites reveal the lineage of
            human salivary and pancreatic amylase genes from a single gene
            during primate evolution
  JOURNAL   Mol. Cell. Biol. 10 (6), 2513-2520 (1990)
   PUBMED   1692956
REFERENCE   2  (bases 1 to 1988)
  AUTHORS   Samuelson,L.C., Wiebauer,K., Gumucio,D.L. and Meisler,M.H.
  TITLE     Expression of the human amylase genes: recent origin of a salivary
            amylase promoter from an actin pseudogene
  JOURNAL   Nucleic Acids Res. 16 (17), 8261-8276 (1988)
   PUBMED   2458567
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AY129015.1 and AC105272.2.
            On Jan 8, 2009 this sequence version replaced gi:212549740.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AY129015.1 [ECO:0000345]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-78                AY129015.1         1-78
            79-231              AY129015.1         80-232
            232-1745            AY129015.1         234-1747
            1746-1988           AC105272.2         21456-21698
FEATURES             Location/Qualifiers
     source          1..1988
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p21.1"
     gene            1..1988
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /note="actin, gamma 1 pseudogene 4"
                     /pseudo
                     /db_xref="GeneID:648740"
                     /db_xref="HGNC:149"
     misc_RNA        1..1988
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /product="actin, gamma 1 pseudogene 4"
                     /pseudo
                     /db_xref="GeneID:648740"
                     /db_xref="HGNC:149"
     exon            1..1988
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       30..31
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:58457409"
     variation       79
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190701357"
     variation       168
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113695654"
     variation       175
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183268316"
     variation       255
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189208271"
     variation       262
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74776140"
     variation       434
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3762407"
     variation       467
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192896538"
     variation       655
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183777813"
     variation       671
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187913470"
     variation       781
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191831804"
     variation       784
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371628291"
     variation       864
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183616642"
     variation       919
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144628009"
     variation       920
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75516768"
     variation       998
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188326986"
     variation       1003
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191587590"
     variation       1030
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185544258"
     variation       1122
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138520891"
     variation       1133
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12132911"
     variation       1136
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368294030"
     variation       1157
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141667811"
     variation       1171
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190759660"
     variation       1257
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146220621"
     variation       1411
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147998703"
     variation       1430
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181682266"
     variation       1482..1483
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35720318"
     variation       1514
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11807489"
     variation       1623
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141522949"
     variation       1698
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17532330"
     variation       1702
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188428536"
     variation       1741
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371438424"
     variation       1787
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181204320"
     variation       1874
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184908191"
     variation       1881
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189666520"
     variation       1918
                     /gene="ACTG1P4"
                     /gene_synonym="ACTGP4"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369575068"
ORIGIN      


gtgtgtgtgtgtgtgtgtgtgtgtgtgtgtacactgccagaggtttaaaaaggttaagattttatcagtaagaaaaaaccagtcacctctgccagcccatgcaccatgttgtcctgccgctccactgtcccactcctccaccagtcgcaatggaagaagagattgccgtactggtgattgacaatggctccagcatgtgcaaagctggctttgctggggacgacaacccccagccatgtttccttccatcatcggtgcccccggcaccagggcatgatggtgggcatgggccagagggactcctatgtgggctacatggctgagagcaagcacagtatcctgaccctgaagtacccccattaagcatggtatcatgaccaactgggatgacatagagaagatctggcatcacaccttctacaagggactgcacatggccttggaggagcacctggtgctgctgaccgaggaccccctgaacctcaaggccaacagagagaagatgactcagatcatgtttgataccttcaacaccctggccatgtacgtggccatccaggctaggctgtccctctacacctgtggttgcacactggcattgtcatgggctttggagatggggtcacccacatggtgcccatctataagggctacgccctccctgacaccattctgcatctggacctggctggccaggacctgaccaactacctcatgaagatccttaccaaggttggctatagcttcagcaccactgccgagcgggagatcagacactacgtcaaggagaaactgtgctatgttgccctggactttgagcagtagatggccactgccacatcctcctcctccctggagaagagatatgagctgcctgatggccatgtcatcaccatcggcaatgaggttgcagtgtcccgagacgctgttccagccttccttcctggacatggaatcttgtggcatccacccagaccatcttcaactccatcatgaagtgtgacgtggacatccgcaaagacctgtaggccaacacggtgctatctggtggcaacatgtacccaggcatcaccgacaggatgcagaaggagatcaccacccgggcacctagcaccatgaagatcaagatgatcgcatccccagagcacaagtactccgtgtggatcagcggctccatcctggcctcactgtcagccttccagcagatgtggattagcaagcaatagtacaatgacttggccccctccatcgtccaccgcaaatgcttctaaatggactgtgagcagatggctagcaattgcttcatgggttaattcagaagtaaaaatttgcccctggcaaatgcatacacctcatgctagcctcaccaaactggaataagccttagaaaataagttgtctttaaagcttgtatctgatatcagcactggattgtagaacttgttcctgattttgacattgtattcaagttaactgttccccttggtatctgtacatatctttgatttcagtctttagtacatgtggcttggtcacttcatggctaaaaacgtacttgtggaagacaagtctggcttggtgagtctgcatggccagcagtctctgatctgtgcagggtattaatgtgtcaggactgagtgttctgggatttgtctacaggctggtaagggctccttaaccagttgtttctgtcctgtcggtctgtcagggttggaaagtccaagccataggacccagtttcctttcttagcttctgttgtctgccagaacaccatgggctgttactcgccttgagttggaagcggtttgcatttatacctataaatgtattcatccttttaatttatgtaaagtttttttgtatgcaattctcgatctttaaagagatgacaacaaattttggttttctactgttacgtgagaacattaggccccagcaatatatcattgtgtatggaaaaataaaagtgctgccagaaccaaaaaaa
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.