Home |
Help |
Advanced search
2025-05-09 19:07:56, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_052931 2751 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 2,
mRNA.
ACCESSION NM_052931
VERSION NM_052931.4 GI:296040489
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2751)
AUTHORS Bolduan,S., Hubel,P., Reif,T., Lodermeyer,V., Hohne,K., Fritz,J.V.,
Sauter,D., Kirchhoff,F., Fackler,O.T., Schindler,M. and Schubert,U.
TITLE HIV-1 Vpu affects the anterograde transport and the glycosylation
pattern of NTB-A
JOURNAL Virology 440 (2), 190-203 (2013)
PUBMED 23528733
REMARK GeneRIF: Together, these results suggest that the reduction of
NTB-A from the cell surface is associated with the Vpu-mediated
effect on the glycosylation pattern of newly synthesized NTB-A
molecules.
REFERENCE 2 (bases 1 to 2751)
AUTHORS Chatterjee,M., Hedrich,C.M., Rauen,T., Ioannidis,C., Terhorst,C.
and Tsokos,G.C.
TITLE CD3-T cell receptor co-stimulation through SLAMF3 and SLAMF6
receptors enhances RORgammat recruitment to the IL17A promoter in
human T lymphocytes
JOURNAL J. Biol. Chem. 287 (45), 38168-38177 (2012)
PUBMED 22989874
REMARK GeneRIF: Data indicate that the dominance of the SLAMF3/SLAMF6
pathway in inducing IL-17A production can be attributed to an
increased nuclear abundance and recruitment of RORgammat to the
IL17A promoter.
REFERENCE 3 (bases 1 to 2751)
AUTHORS Chatterjee,M., Rauen,T., Kis-Toth,K., Kyttaris,V.C., Hedrich,C.M.,
Terhorst,C. and Tsokos,G.C.
TITLE Increased expression of SLAM receptors SLAMF3 and SLAMF6 in
systemic lupus erythematosus T lymphocytes promotes Th17
differentiation
JOURNAL J. Immunol. 188 (3), 1206-1212 (2012)
PUBMED 22184727
REMARK GeneRIF: SLAMF3 and SLAMF6 T cell surface expression and IL-17
levels significantly correlate with disease activity in systemic
lupus erythematosus patients
REFERENCE 4 (bases 1 to 2751)
AUTHORS Chatterjee,M., Kis-Toth,K., Thai,T.H., Terhorst,C. and Tsokos,G.C.
TITLE SLAMF6-driven co-stimulation of human peripheral T cells is
defective in SLE T cells
JOURNAL Autoimmunity 44 (3), 211-218 (2011)
PUBMED 21231893
REMARK GeneRIF: Although the expression of SLAMF6 on the surface of T
cells from patients with systemic lupus erythematosus (SLE) T cells
is comparable to that on the normal T cells, engagement of SLAMF6
results in severely reduced Th1 and IL-2 cytokine production
REFERENCE 5 (bases 1 to 2751)
AUTHORS Shah,A.H., Sowrirajan,B., Davis,Z.B., Ward,J.P., Campbell,E.M.,
Planelles,V. and Barker,E.
TITLE Degranulation of natural killer cells following interaction with
HIV-1-infected cells is hindered by downmodulation of NTB-A by Vpu
JOURNAL Cell Host Microbe 8 (5), 397-409 (2010)
PUBMED 21075351
REMARK GeneRIF: Vpu downmodulation of NTB-A protects the infected cell
from lysis by NK cells.
REFERENCE 6 (bases 1 to 2751)
AUTHORS Fraser,C.C., Howie,D., Morra,M., Qiu,Y., Murphy,C., Shen,Q.,
Gutierrez-Ramos,J.C., Coyle,A., Kingsbury,G.A. and Terhorst,C.
TITLE Identification and characterization of SF2000 and SF2001, two new
members of the immune receptor SLAM/CD2 family
JOURNAL Immunogenetics 53 (10-11), 843-850 (2002)
PUBMED 11862385
REFERENCE 7 (bases 1 to 2751)
AUTHORS Bottino,C., Falco,M., Parolini,S., Marcenaro,E., Augugliaro,R.,
Sivori,S., Landi,E., Biassoni,R., Notarangelo,L.D., Moretta,L. and
Moretta,A.
TITLE NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface
molecule contributing to the inability of natural killer cells to
kill Epstein-Barr virus-infected B cells in X-linked
lymphoproliferative disease
JOURNAL J. Exp. Med. 194 (3), 235-246 (2001)
PUBMED 11489943
REMARK Erratum:[J Exp Med 2001 Sep 3;194(5):following 703]
REFERENCE 8 (bases 1 to 2751)
AUTHORS Lee,Y.J., Luisiri,P. and Clark,M.R.
TITLE A novel complex, p40/42, is constitutively associated with the B
cell antigen receptor and phosphorylated upon receptor stimulation
JOURNAL J. Immunol. 157 (9), 3828-3837 (1996)
PUBMED 8892612
REFERENCE 9 (bases 1 to 2751)
AUTHORS Kong,G., Dalton,M., Bubeck Wardenburg,J., Straus,D., Kurosaki,T.
and Chan,A.C.
TITLE Distinct tyrosine phosphorylation sites in ZAP-70 mediate
activation and negative regulation of antigen receptor function
JOURNAL Mol. Cell. Biol. 16 (9), 5026-5035 (1996)
PUBMED 8756661
REFERENCE 10 (bases 1 to 2751)
AUTHORS Hercend,T., Meuer,S., Brennan,A., Edson,M.A., Acuto,O.,
Reinherz,E.L., Schlossman,S.F. and Ritz,J.
TITLE Natural killer-like function of activated T lymphocytes:
differential blocking effects of monoclonal antibodies specific for
a 90-kDa clonotypic structure
JOURNAL Cell. Immunol. 86 (2), 381-392 (1984)
PUBMED 6610481
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB197632.1, BC113893.1 and
AK125624.1.
On May 14, 2010 this sequence version replaced gi:38327616.
Summary: The protein encoded by this gene is a type I transmembrane
protein, belonging to the CD2 subfamily of the immunoglobulin
superfamily. This encoded protein is expressed on Natural killer
(NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation
and associates with the Src homology 2 domain-containing protein
(SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs).
It functions as a coreceptor in the process of NK cell activation.
It can also mediate inhibitory signals in NK cells from X-linked
lymphoproliferative patients. Alternative splicing results in
multiple transcript variants encoding distinct isoforms.[provided
by RefSeq, May 2010].
Transcript Variant: This variant (2) uses an alternate splice site
in the 3' coding region, compared to variant 1, which results in an
isoform (2) that is one amino acid shorter than isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK125624.1, AJ277141.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-43 DB197632.1 1-43
44-1253 BC113893.1 1-1210
1254-2751 AK125624.1 1253-2750
FEATURES Location/Qualifiers
source 1..2751
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q23.2"
gene 1..2751
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="SLAM family member 6"
/db_xref="GeneID:114836"
/db_xref="HGNC:21392"
/db_xref="HPRD:05920"
/db_xref="MIM:606446"
exon 1..119
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
STS 44..1494
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/db_xref="UniSTS:486452"
CDS 71..1066
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="isoform 2 precursor is encoded by transcript
variant 2; activating NK receptor; natural killer-, T- and
B-cell antigen; NTBA receptor; NK-T-B-antigen"
/codon_start=1
/product="SLAM family member 6 isoform 2 precursor"
/protein_id="NP_443163.1"
/db_xref="GI:16418407"
/db_xref="CCDS:CCDS1205.1"
/db_xref="GeneID:114836"
/db_xref="HGNC:21392"
/db_xref="HPRD:05920"
/db_xref="MIM:606446"
/translation="
MLWLFQSLLFVFCFGPGNVVSQSSLTPLMVNGILGESVTLPLEFPAGEKVNFITWLFNETSLAFIVPHETKSPEIHVTNPKQGKRLNFTQSYSLQLSNLKMEDTGSYRAQISTKTSAKLSSYTLRILRQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV
"
sig_peptide 71..133
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
misc_feature 131..409
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="Immunoglobulin V-set domain; Region: V-set;
pfam07686"
/db_xref="CDD:203725"
mat_peptide 134..1063
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/product="SLAM family member 6 isoform 2"
misc_feature 164..451
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="N-terminal immunoglobulin (Ig)-like domain of the
signaling lymphocyte activation molecule (SLAM) family,
CD84_like; Region: Ig_SLAM-CD84_like_N; cd05775"
/db_xref="CDD:143252"
misc_feature order(224..226,230..232,392..394,398..400,404..406)
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:143252"
misc_feature 470..667
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/note="Immunoglobulin domain; Region: Ig; cl11960"
/db_xref="CDD:213125"
misc_feature 749..811
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q96DU3.3);
transmembrane region"
misc_feature 887..889
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site"
misc_feature 899..901
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q96DU3.3); phosphorylation site"
misc_feature 992..994
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphotyrosine; propagated from
UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site"
exon 120..452
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 453..716
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
variation 556
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:35414223"
exon 717..827
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
variation 800
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/replace="c"
/replace="t"
/db_xref="dbSNP:34355503"
exon 828..866
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 867..946
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 947..1018
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
exon 1019..2743
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/inference="alignment:Splign:1.39.8"
variation 2454
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/replace="a"
/replace="t"
/db_xref="dbSNP:634791"
STS 2487..2655
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/standard_name="G35510"
/db_xref="UniSTS:44150"
STS 2529..2619
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
/standard_name="D8S2279"
/db_xref="UniSTS:473907"
polyA_signal 2709..2714
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_signal 2713..2718
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_signal 2717..2722
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_signal 2722..2727
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
polyA_site 2743
/gene="SLAMF6"
/gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
SF2000"
ORIGIN
agtttatgacagaagggcaaaaacattgactgcctcaaggtctcaagcaccagtcttcaccgcggaaagcatgttgtggctgttccaatcgctcctgtttgtcttctgctttggcccagggaatgtagtttcacaaagcagcttaaccccattgatggtgaacgggattctgggggagtcagtaactcttcccctggagtttcctgcaggagagaaggtcaacttcatcacttggcttttcaatgaaacatctcttgccttcatagtaccccatgaaaccaaaagtccagaaatccacgtgactaatccgaaacagggaaagcgactgaacttcacccagtcctactccctgcaactcagcaacctgaagatggaagacacaggctcttacagagcccagatatccacaaagacctctgcaaagctgtccagttacactctgaggatattaagacaactgaggaacatacaagttaccaatcacagtcagctatttcagaatatgacctgtgagctccatctgacttgctctgtggaggatgcagatgacaatgtctcattcagatgggaggccttgggaaacacactttcaagtcagccaaacctcactgtctcctgggaccccaggatttccagtgaacaggactacacctgcatagcagagaatgctgtcagtaatttatccttctctgtctctgcccagaagctttgcgaagatgttaaaattcaatatacagataccaaaatgattctgtttatggtttctgggatatgcatagtcttcggtttcatcatactgctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcgaacacagggccccgagtccgcaaggaacctagagtatgtttcagtgtctccaacgaacaacactgtgtatgcttcagtcactcattcaaacagggaaacagaaatctggacacctagagaaaatgatactatcacaatttactccacaattaatcattccaaagagagtaaacccactttttccagggcaactgcccttgacaatgtcgtgtaagttgctgaaaggcctcagaggaattcgggaatgacacgtcttctgatcccatgagacagaacaaagaacaggaagcttggttcctgttgttcctggcaacagaatttgaatatctaggataggatgatcacctccagtccttcggacttaaacctgcctacctgagtcaaacacctaaggataacatcatttccagcatgtggttcaaataatattttccaatccacttcaggccaaaacatgctaaagataacacaccagcacattgactctctctttgataactaagcaaatggaattatggttgacagagagtttatgatccagaagacaaccacttctctccttttagaaagcagcaggattgacttattgagaaataatgcagtgtgttggttacatgtgtagtctctggagttggatgggcccatcctgatacaagttgagcatcccttgtctgaaatgcttgggattagaaatgtttcagatttcaattttttttcagattttggaatatttgcattatatttagcggttgagtatccaaatccaaaaatccaaaattcaaaatgctccaataagcatttcccttgagtttcattgatgtcgatgcagtgctcaaaatctcagattttggagcattttggatattggatttttggatttgggatgctcaacttgtacaatgtttattagacacatctcctgggacatactgcctaaccttttggagccttagtctcccagactgaaaaaggaagaggatggtattacatcagctccattgtttgagccaagaatctaagtcatccctgactccagtgtctttgtcaccaggccctttggactctacctcagaaatatttcttggaccttccacttctcctccaactccttgaccaccatcctgtatccaaccatcaccacctctaacctgaatcctaccttaagatcagaacagttgtcctcacttttgttcttgtccctctccaacccactctccacaagatggccagagtaatgtttttaatataaattggatccttcagtttcctgcttaaaaccctgcaggtttcccaatgcactcagaaagaaatccagtttccatggccctggatggtctggcccacctccagcctcagctagcattacccttctgacactctctatgtagcctccctgatcttctttcagctcctctattaaaggaaaagttctttatgttaattatttacatcttcctgcaggcccttcctctgcctgctggggtcctcctattctttaggtttaattttaaatatgtcacctcctaagagaaaccttcccagaccactctttctaaaatgaatcttctaggctgggcatggtggctcacacctgtaatccctgtactttgggaggccaaggggggagatcacttgaggtcaggagttcaagaccagcctggccaacttggtgaaaccccgtctttactaaaaatacaaaaaaattagccaggcgtggtggtgcacccctaaaatcccagctacttgagagactgaggcaggagaatcgcttgaacccaggaggtggaggttccagtgagccaaaatcatgccaatgtattccagtctgggtgacagagtgagactctgtctcaaaaaataaataaataaaataaaatgaaatagatcttataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:114836 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
GeneID:114836 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:114836 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.