Home |
Help |
Advanced search
2025-05-09 18:36:37, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001134738 3086 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens B-cell CLL/lymphoma 6 (BCL6), transcript variant 3,
mRNA.
ACCESSION NM_001134738
VERSION NM_001134738.1 GI:197927146
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3086)
AUTHORS Horn H, Ziepert M, Becher C, Barth TF, Bernd HW, Feller AC, Klapper
W, Hummel M, Stein H, Hansmann ML, Schmelter C, Moller P, Cogliatti
S, Pfreundschuh M, Schmitz N, Trumper L, Siebert R, Loeffler M,
Rosenwald A and Ott G.
CONSRTM German High-Grade Non-Hodgkin Lymphoma Study Group
TITLE MYC status in concert with BCL2 and BCL6 expression predicts
outcome in diffuse large B-cell lymphoma
JOURNAL Blood 121 (12), 2253-2263 (2013)
PUBMED 23335369
REMARK GeneRIF: Protein expression patterns of MYC, BCL2 and BCL6, and MYC
rearrangements were predictive of outcome and provided prognostic
information independent of the International Prognostic Index (IPI)
for overall survival and event-free survival.
REFERENCE 2 (bases 1 to 3086)
AUTHORS Pillai,R.K., Sathanoori,M., Van Oss,S.B. and Swerdlow,S.H.
TITLE Double-hit B-cell lymphomas with BCL6 and MYC translocations are
aggressive, frequently extranodal lymphomas distinct from BCL2
double-hit B-cell lymphomas
JOURNAL Am. J. Surg. Pathol. 37 (3), 323-332 (2013)
PUBMED 23348205
REMARK GeneRIF: Double-hit BCL6/MYC lymphomas are aggressive, frequently
involve extranodal sites, and often have a germinal center
phenotype
REFERENCE 3 (bases 1 to 3086)
AUTHORS Tucci,F.A., Broering,R., Johansson,P., Schlaak,J.F. and Kuppers,R.
TITLE B cells in chronically hepatitis C virus-infected individuals lack
a virus-induced mutation signature in the TP53, CTNNB1, and BCL6
genes
JOURNAL J. Virol. 87 (5), 2956-2962 (2013)
PUBMED 23269799
REMARK GeneRIF: study concludes that in chronic HCV carriers, the virus
does not generally induce mutations in the cancer-related genes
TP53, CTNNB1, and BCL6 in B cells
REFERENCE 4 (bases 1 to 3086)
AUTHORS Basso,K., Schneider,C., Shen,Q., Holmes,A.B., Setty,M., Leslie,C.
and Dalla-Favera,R.
TITLE BCL6 positively regulates AID and germinal center gene expression
via repression of miR-155
JOURNAL J. Exp. Med. 209 (13), 2455-2465 (2012)
PUBMED 23166356
REMARK GeneRIF: Among BCL6 validated targets, miR-155 and miR-361 directly
modulate AID expression, indicating that via repression of these
miRNAs, BCL6 up-regulates AID.
REFERENCE 5 (bases 1 to 3086)
AUTHORS Hancock,D.B., Artigas,M.S., Gharib,S.A., Henry,A., Manichaikul,A.,
Ramasamy,A., Loth,D.W., Imboden,M., Koch,B., McArdle,W.L.,
Smith,A.V., Smolonska,J., Sood,A., Tang,W., Wilk,J.B., Zhai,G.,
Zhao,J.H., Aschard,H., Burkart,K.M., Curjuric,I., Eijgelsheim,M.,
Elliott,P., Gu,X., Harris,T.B., Janson,C., Homuth,G., Hysi,P.G.,
Liu,J.Z., Loehr,L.R., Lohman,K., Loos,R.J., Manning,A.K.,
Marciante,K.D., Obeidat,M., Postma,D.S., Aldrich,M.C.,
Brusselle,G.G., Chen,T.H., Eiriksdottir,G., Franceschini,N.,
Heinrich,J., Rotter,J.I., Wijmenga,C., Williams,O.D., Bentley,A.R.,
Hofman,A., Laurie,C.C., Lumley,T., Morrison,A.C., Joubert,B.R.,
Rivadeneira,F., Couper,D.J., Kritchevsky,S.B., Liu,Y., Wjst,M.,
Wain,L.V., Vonk,J.M., Uitterlinden,A.G., Rochat,T., Rich,S.S.,
Psaty,B.M., O'Connor,G.T., North,K.E., Mirel,D.B., Meibohm,B.,
Launer,L.J., Khaw,K.T., Hartikainen,A.L., Hammond,C.J., Glaser,S.,
Marchini,J., Kraft,P., Wareham,N.J., Volzke,H., Stricker,B.H.,
Spector,T.D., Probst-Hensch,N.M., Jarvis,D., Jarvelin,M.R.,
Heckbert,S.R., Gudnason,V., Boezen,H.M., Barr,R.G., Cassano,P.A.,
Strachan,D.P., Fornage,M., Hall,I.P., Dupuis,J., Tobin,M.D. and
London,S.J.
TITLE Genome-wide joint meta-analysis of SNP and SNP-by-smoking
interaction identifies novel loci for pulmonary function
JOURNAL PLoS Genet. 8 (12), E1003098 (2012)
PUBMED 23284291
REFERENCE 6 (bases 1 to 3086)
AUTHORS Flenghi,L., Ye,B.H., Fizzotti,M., Bigerna,B., Cattoretti,G.,
Venturi,S., Pacini,R., Pileri,S., Lo Coco,F., Pescarmona,E. et al.
TITLE A specific monoclonal antibody (PG-B6) detects expression of the
BCL-6 protein in germinal center B cells
JOURNAL Am. J. Pathol. 147 (2), 405-411 (1995)
PUBMED 7639334
REFERENCE 7 (bases 1 to 3086)
AUTHORS Cattoretti,G., Chang,C.C., Cechova,K., Zhang,J., Ye,B.H.,
Falini,B., Louie,D.C., Offit,K., Chaganti,R.S. and Dalla-Favera,R.
TITLE BCL-6 protein is expressed in germinal-center B cells
JOURNAL Blood 86 (1), 45-53 (1995)
PUBMED 7795255
REFERENCE 8 (bases 1 to 3086)
AUTHORS Onizuka,T., Moriyama,M., Yamochi,T., Kuroda,T., Kazama,A.,
Kanazawa,N., Sato,K., Kato,T., Ota,H. and Mori,S.
TITLE BCL-6 gene product, a 92- to 98-kD nuclear phosphoprotein, is
highly expressed in germinal center B cells and their neoplastic
counterparts
JOURNAL Blood 86 (1), 28-37 (1995)
PUBMED 7795234
REFERENCE 9 (bases 1 to 3086)
AUTHORS Lichter,P., Bray,P., Ried,T., Dawid,I.B. and Ward,D.C.
TITLE Clustering of C2-H2 zinc finger motif sequences within telomeric
and fragile site regions of human chromosomes
JOURNAL Genomics 13 (4), 999-1007 (1992)
PUBMED 1505991
REFERENCE 10 (bases 1 to 3086)
AUTHORS Bray,P., Lichter,P., Thiesen,H.J., Ward,D.C. and Dawid,I.B.
TITLE Characterization and mapping of human genes encoding zinc finger
proteins
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (21), 9563-9567 (1991)
PUBMED 1946370
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from Z21943.1, EU883531.1,
BC150184.1, BC146796.1 and AW337942.1.
Summary: The protein encoded by this gene is a zinc finger
transcription factor and contains an N-terminal POZ domain. This
protein acts as a sequence-specific repressor of transcription, and
has been shown to modulate the transcription of START-dependent
IL-4 responses of B cells. This protein can interact with a variety
of POZ-containing proteins that function as transcription
corepressors. This gene is found to be frequently translocated and
hypermutated in diffuse large-cell lymphoma (DLCL), and may be
involved in the pathogenesis of DLCL. Alternatively spliced
transcript variants encoding different protein isoforms have been
found for this gene. [provided by RefSeq, Sep 2008].
Transcript Variant: This variant (3) lacks a coding exon, as
compared to variant 1. The reading frame is not affected and the
resulting isoform (2) lacks an internal segment, as compared to
isoform 2.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: EU139066.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-49 Z21943.1 36-84
50-1087 EU883531.1 1-1038
1088-1589 BC150184.1 1120-1621
1590-2002 EU883531.1 1541-1953
2003-3079 BC146796.1 2233-3309
3080-3086 AW337942.1 1-7 c
FEATURES Location/Qualifiers
source 1..3086
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3q27"
gene 1..3086
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="B-cell CLL/lymphoma 6"
/db_xref="GeneID:604"
/db_xref="HGNC:1001"
/db_xref="MIM:109565"
exon 1..39
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
misc_feature 5..7
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="upstream in-frame stop codon"
exon 40..210
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
CDS 50..2002
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="isoform 2 is encoded by transcript variant 3;
lymphoma-associated zinc finger gene on chromosome 3; zinc
finger protein 51; cys-his2 zinc finger transcription
factor; zinc finger transcription factor BCL6S; B-cell
lymphoma 6 protein transcript; zinc finger and BTB
domain-containing protein 27; BCL-5; BCL-6; protein LAZ-3;
B-cell lymphoma 5 protein"
/codon_start=1
/product="B-cell lymphoma 6 protein isoform 2"
/protein_id="NP_001128210.1"
/db_xref="GI:197927147"
/db_xref="CCDS:CCDS46975.1"
/db_xref="GeneID:604"
/db_xref="HGNC:1001"
/db_xref="MIM:109565"
/translation="
MASPADSCIQFTRHASDVLLNLNRLRSRDILTDVVIVVSREQFRAHKTVLMACSGLFYSIFTDQLKCNLSVINLDPEINPEGFCILLDFMYTSRLNLREGNIMAVMATAMYLQMEHVVDTCRKFIKASEAEMVSAIKPPREEFLNSRMLMPQDIMAYRGREVVENNLPLRSAPGCESRAFAPSLYSGLSTPPASYSMYSHLPVSSLLFSDEEFRDVRMPVANPFPKERALPCDSARPVPGEYSRPTLEVSPNVCHSNIYSPKETIPEEARSDMHYSVAEGLKPAAPSARNAPYFPCDKASKEEERPSSEDEIALHFEPPNAPLNRKGLVSPQSPQKSDCQPNSPTESCSSKNACILQASGSPPAKSPTDPKACNWKKYKFIVLNSLNQNAKPEGPEQAELGRLSPRAYTAPPACQPPMEPENLDLQSPTKLSASGEDSTIPQASRLNNIVNRSMTGSPRSSSESHSPLYMHPPKCTSCGSQSPQHAEMCLHTAGPTFPEEMGETQSEYSDSSCGEKPYRCNICGAQFNRPANLKTHTRIHSGEKPYKCETCGARFVQVAHLRAHVLIHTGEKPYPCEICGTRFRHLQTLKSHLRIHTGEKPYHCEKCNLHFRHKSQLRLHLRQKHGAITNTKVQYRVSATDLPPELPKAC
"
misc_feature 113..427
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="BTB/POZ domain; Region: BTB; pfam00651"
/db_xref="CDD:201372"
misc_feature 1604..1669
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="Zinc finger, C2H2 type; Region: zf-C2H2; cl15478"
/db_xref="CDD:210117"
misc_feature 1643..1720
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="Zinc-finger double domain; Region: zf-H2C2_2;
pfam13465"
/db_xref="CDD:205643"
misc_feature 1727..1804
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="Zinc-finger double domain; Region: zf-H2C2_2;
pfam13465"
/db_xref="CDD:205643"
misc_feature 1814..1888
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/note="Zinc-finger double domain; Region: zf-H2C2_2;
pfam13465"
/db_xref="CDD:205643"
variation 131
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="a"
/replace="c"
/db_xref="dbSNP:11545363"
exon 211..432
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
variation 363
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="g"
/replace="t"
/db_xref="dbSNP:200844445"
exon 433..1404
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
variation 567
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="c"
/replace="g"
/db_xref="dbSNP:11545364"
STS 676..1057
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/standard_name="PMC309637P2"
/db_xref="UniSTS:272596"
variation 676
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="c"
/replace="t"
/db_xref="dbSNP:33922911"
variation 784
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="a"
/replace="g"
/db_xref="dbSNP:2228258"
variation 804
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="a"
/replace="g"
/db_xref="dbSNP:34463990"
variation 1210
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056932"
variation 1227
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="a"
/replace="g"
/db_xref="dbSNP:1056933"
exon 1405..1589
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
variation 1465
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="c"
/replace="g"
/db_xref="dbSNP:201059480"
variation 1526
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="a"
/replace="g"
/db_xref="dbSNP:2229362"
exon 1590..1720
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
STS 1686..1788
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/standard_name="BCL6"
/db_xref="UniSTS:505525"
exon 1721..1858
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
exon 1859..3083
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/inference="alignment:Splign:1.39.8"
variation 1907
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056936"
variation 2152
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/replace="a"
/replace="g"
/db_xref="dbSNP:3733019"
STS 2759..3037
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/standard_name="SHGC-77610"
/db_xref="UniSTS:82745"
STS 2821..2966
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/standard_name="SHGC-64334"
/db_xref="UniSTS:34563"
STS 2843..3049
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/standard_name="STS-W46183"
/db_xref="UniSTS:74552"
STS 2854..3021
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
/standard_name="RH70520"
/db_xref="UniSTS:64302"
polyA_signal 3058..3063
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
polyA_site 3083
/gene="BCL6"
/gene_synonym="BCL5; BCL6A; LAZ3; ZBTB27; ZNF51"
ORIGIN
gttttgagcaaaattttggactgtgaagcaaggcattggtgaagacaaaatggcctcgccggctgacagctgtatccagttcacccgccatgccagtgatgttcttctcaaccttaatcgtctccggagtcgagacatcttgactgatgttgtcattgttgtgagccgtgagcagtttagagcccataaaacggtcctcatggcctgcagtggcctgttctatagcatctttacagaccagttgaaatgcaaccttagtgtgatcaatctagatcctgagatcaaccctgagggattctgcatcctcctggacttcatgtacacatctcggctcaatttgcgggagggcaacatcatggctgtgatggccacggctatgtacctgcagatggagcatgttgtggacacttgccggaagtttattaaggccagtgaagcagagatggtttctgccatcaagcctcctcgtgaagagttcctcaacagccggatgctgatgccccaagacatcatggcctatcggggtcgtgaggtggtggagaacaacctgccactgaggagcgcccctgggtgtgagagcagagcctttgcccccagcctgtacagtggcctgtccacaccgccagcctcttattccatgtacagccacctccctgtcagcagcctcctcttctccgatgaggagtttcgggatgtccggatgcctgtggccaaccccttccccaaggagcgggcactcccatgtgatagtgccaggccagtccctggtgagtacagccggccgactttggaggtgtcccccaatgtgtgccacagcaatatctattcacccaaggaaacaatcccagaagaggcacgaagtgatatgcactacagtgtggctgagggcctcaaacctgctgccccctcagcccgaaatgccccctacttcccttgtgacaaggccagcaaagaagaagagagaccctcctcggaagatgagattgccctgcatttcgagccccccaatgcacccctgaaccggaagggtctggttagtccacagagcccccagaaatctgactgccagcccaactcgcccacagagtcctgcagcagtaagaatgcctgcatcctccaggcttctggctcccctccagccaagagccccactgaccccaaagcctgcaactggaagaaatacaagttcatcgtgctcaacagcctcaaccagaatgccaaaccagaggggcctgagcaggctgagctgggccgcctttccccacgagcctacacggccccacctgcctgccagccacccatggagcctgagaaccttgacctccagtccccaaccaagctgagtgccagcggggaggactccaccatcccacaagccagccggctcaataacatcgttaacaggtccatgacgggctctccccgcagcagcagcgagagccactcaccactctacatgcaccccccgaagtgcacgtcctgcggctctcagtccccacagcatgcagagatgtgcctccacaccgctggccccacgttccctgaggagatgggagagacccagtctgagtactcagattctagctgtggtgagaaaccctatcgttgcaacatctgtggggcccagttcaaccggccagccaacctgaaaacccacactcgaattcactctggagagaagccctacaaatgcgaaacctgcggagccagatttgtacaggtggcccacctccgtgcccatgtgcttatccacactggtgagaagccctatccctgtgaaatctgtggcacccgtttccggcaccttcagactctgaagagccacctgcgaatccacacaggagagaaaccttaccattgtgagaagtgtaacctgcatttccgtcacaaaagccagctgcgacttcacttgcgccagaagcatggcgccatcaccaacaccaaggtgcaataccgcgtgtcagccactgacctgcctccggagctccccaaagcctgctgaagcatggagtgttgatgctttcgtctccagccccttctcagaatctacccaaaggatactgtaacactttacaatgttcatcccatgatgtagtgcctctttcatccactagtgcaaatcatagctgggggttgggggtggtgggggtcggggcctgggggactgggagccgcagcagctccccctcccccactgccataaaacattaagaaaatcatattgcttcttctcctatgtgtaaggtgaaccatgtcagcaaaaagcaaaatcattttatatgtcaaagcaggggagtatgcaaaagttctgacttgactttagtctgcaaaatgaggaatgtatatgttttgtgggaacagatgtttcttttgtatgtaaatgtgcattcttttaaaagacaagacttcagtatgttgtcaaagagagggctttaatttttttaaccaaaggtgaaggaatatatggcagagttgtaaatatataaatatatatatatataaaataaatatatataaacctaaaaaagatatattaaaaatataaaactgcgttaaaggctcgattttgtatctgcaggcagacacggatctgagaatctttattgagaaagagcacttaagagaatattttaagtattgcatctgtataagtaagaaaatattttgtctaaaatgcctcagtgtatttgtatttttttgcaagtgaaggtttacaatttacaaagtgtgtattaaaaaaaacaaaaagaacaaaaaaatctgcagaaggaaaaatgtgtaattttgttctagttttcagtttgtatatacccgtacaacgtgtcctcacggtgccttttttcacggaagttttcaatgatgggcgagcgtgcaccatccctttttgaagtgtaggcagacacagggacttgaagttgttactaactaaactctctttgggaatgtttgtctcatcccattctgcgtcatgcttgtgttataactactccggagacagggtttggctgtgtctaaactgcattaccgcgttgtaaaatatagctgtacaaatataagaataaaatgttgaaaagtcaaactggaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:604 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
GeneID:604 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IMP
GeneID:604 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:604 -> Molecular function: GO:0031490 [chromatin DNA binding] evidence: IEA
GeneID:604 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IDA
GeneID:604 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
GeneID:604 -> Biological process: GO:0000060 [protein import into nucleus, translocation] evidence: IGI
GeneID:604 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:604 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IEA
GeneID:604 -> Biological process: GO:0001953 [negative regulation of cell-matrix adhesion] evidence: IEA
GeneID:604 -> Biological process: GO:0002467 [germinal center formation] evidence: IEA
GeneID:604 -> Biological process: GO:0002634 [regulation of germinal center formation] evidence: NAS
GeneID:604 -> Biological process: GO:0002829 [negative regulation of type 2 immune response] evidence: IEA
GeneID:604 -> Biological process: GO:0002903 [negative regulation of B cell apoptotic process] evidence: NAS
GeneID:604 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:604 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
GeneID:604 -> Biological process: GO:0007266 [Rho protein signal transduction] evidence: IEA
GeneID:604 -> Biological process: GO:0007283 [spermatogenesis] evidence: IEA
GeneID:604 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IEA
GeneID:604 -> Biological process: GO:0030036 [actin cytoskeleton organization] evidence: IEA
GeneID:604 -> Biological process: GO:0030183 [B cell differentiation] evidence: IEA
GeneID:604 -> Biological process: GO:0030308 [negative regulation of cell growth] evidence: IDA
GeneID:604 -> Biological process: GO:0030890 [positive regulation of B cell proliferation] evidence: IEA
GeneID:604 -> Biological process: GO:0032319 [regulation of Rho GTPase activity] evidence: IEA
GeneID:604 -> Biological process: GO:0032764 [negative regulation of mast cell cytokine production] evidence: IEA
GeneID:604 -> Biological process: GO:0035024 [negative regulation of Rho protein signal transduction] evidence: IEA
GeneID:604 -> Biological process: GO:0042092 [type 2 immune response] evidence: IEA
GeneID:604 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
GeneID:604 -> Biological process: GO:0043380 [regulation of memory T cell differentiation] evidence: IEA
GeneID:604 -> Biological process: GO:0045629 [negative regulation of T-helper 2 cell differentiation] evidence: IEA
GeneID:604 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
GeneID:604 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: NAS
GeneID:604 -> Biological process: GO:0048294 [negative regulation of isotype switching to IgE isotypes] evidence: IEA
GeneID:604 -> Biological process: GO:0048821 [erythrocyte development] evidence: IEA
GeneID:604 -> Biological process: GO:0050727 [regulation of inflammatory response] evidence: IEA
GeneID:604 -> Biological process: GO:0050776 [regulation of immune response] evidence: NAS
GeneID:604 -> Biological process: GO:0051272 [positive regulation of cellular component movement] evidence: IEA
GeneID:604 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:604 -> Cellular component: GO:0005657 [replication fork] evidence: IDA
GeneID:604 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.