Home |
Help |
Advanced search
2026-01-17 00:56:38, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_019066 4298 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens MAGE-like 2 (MAGEL2), mRNA.
ACCESSION NM_019066
VERSION NM_019066.4 GI:257900507
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4298)
AUTHORS Hao,Y.H., Doyle,J.M., Ramanathan,S., Gomez,T.S., Jia,D., Xu,M.,
Chen,Z.J., Billadeau,D.D., Rosen,M.K. and Potts,P.R.
TITLE Regulation of WASH-dependent actin polymerization and protein
trafficking by ubiquitination
JOURNAL Cell 152 (5), 1051-1064 (2013)
PUBMED 23452853
REMARK GeneRIF: These findings provide a cellular and molecular function
for MAGE-L2-TRIM27 in retrograde transport, including an
unappreciated role of K63-linked ubiquitination and identification
of an activating signal of the WASH regulatory complex.
REFERENCE 2 (bases 1 to 4298)
AUTHORS Fukuo,Y., Kishi,T., Okochi,T., Kitajima,T., Tsunoka,T.,
Okumukura,T., Kinoshita,Y., Kawashima,K., Yamanouchi,Y.,
Umene-Nakano,W., Naitoh,H., Inada,T., Yoshimura,R., Nakamura,J.,
Ozaki,N. and Iwata,N.
TITLE Lack of association between MAGEL2 and schizophrenia and mood
disorders in the Japanese population
JOURNAL Neuromolecular Med. 12 (3), 285-291 (2010)
PUBMED 20467835
REMARK GeneRIF: Results suggest that MAGEL2 may not play a role in the
pathophysiology of schizophrenia and mood disorders in the Japanese
population.
GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 3 (bases 1 to 4298)
AUTHORS Lee,S., Kozlov,S., Hernandez,L., Chamberlain,S.J., Brannan,C.I.,
Stewart,C.L. and Wevrick,R.
TITLE Expression and imprinting of MAGEL2 suggest a role in Prader-willi
syndrome and the homologous murine imprinting phenotype
JOURNAL Hum. Mol. Genet. 9 (12), 1813-1819 (2000)
PUBMED 10915770
REFERENCE 4 (bases 1 to 4298)
AUTHORS Boccaccio,I., Glatt-Deeley,H., Watrin,F., Roeckel,N., Lalande,M.
and Muscatelli,F.
TITLE The human MAGEL2 gene and its mouse homologue are paternally
expressed and mapped to the Prader-Willi region
JOURNAL Hum. Mol. Genet. 8 (13), 2497-2505 (1999)
PUBMED 10556298
REMARK GeneRIF: MAGEL2 gene is imprinted, with preferential expression
from the paternal allele.
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC124309.7.
This sequence is a reference standard in the RefSeqGene project.
On Sep 12, 2009 this sequence version replaced gi:148746205.
Summary: Prader-Willi syndrome (PWS) is caused by the loss of
expression of imprinted genes in chromosome 15q11-q13 region.
Affected individuals exhibit neonatal hypotonia, developmental
delay, and childhood-onset obesity. Necdin (NDN), a gene involved
in the terminal differentiation of neurons, localizes to this
region of the genome and has been implicated as one of the genes
responsible for the etiology of PWS. This gene is structurally
similar to NDN, is also localized to the PWS chromosomal region,
and is paternally imprinted, suggesting a possible role for it in
PWS. [provided by RefSeq, Oct 2010].
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
##RefSeq-Attributes-START##
imprinted gene :: PMID: 10556298, 10915770
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-4298 AC124309.7 95423-99720
FEATURES Location/Qualifiers
source 1..4298
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="15"
/map="15q11-q12"
gene 1..4298
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/note="MAGE-like 2"
/db_xref="GeneID:54551"
/db_xref="HGNC:6814"
/db_xref="MIM:605283"
exon 1..4298
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/inference="alignment:Splign:1.39.8"
misc_feature 27..29
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/note="upstream in-frame stop codon"
CDS 105..3854
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/note="protein nM15; necdin-like protein 1"
/codon_start=1
/product="MAGE-like protein 2"
/protein_id="NP_061939.3"
/db_xref="GI:257900508"
/db_xref="GeneID:54551"
/db_xref="HGNC:6814"
/db_xref="MIM:605283"
/translation="
MSQLSKNLGDSSPPAEAPKPPVYSRPTVLMRAPPASSRAPPVPWDPPPIDLQASLAAWQAPQPAWEAPQGQLPAPVVPMTQPPALGGPIVPAPPLGGPMGKPPTPGVLMVHPPPPGAPMAQPPTPGVLMVHPSAPGAPMAHPPPPGTPMSHPPPPGTPMAHPPPPGTPMAHPPPPGTPMVHPPPPGTPMAHPPPPGTPMAHPPPPGTPMAHPPPPGTPMAHPPPPGTPMAQPPAPGVLMAQPLTPGVLMVQPAAPGAPMVQPPPAAMMTQPQPSGAPMAKPPGPGVLMIHPPGARAPMTQPPASGAPMAQPAAPPAQPMAPPAQPMASWAPQAQPLILQIQSQVIRAPPQVPQGPQAPPAQLATPPGWQATSPGWQATQQGWQATPLTWQTTQVTWQAPAVTWQVPPPMRQGPPPIRPGPPPIRPGPPPVRQAPPLIRQAPPVIRQAPPVIRQAPPVIRQAPAVIRQAPPVIRQAPPVIRQAPPVIRQAPPLIRQAPPPIRPAPQVLATQPPLWQALPPPPPLRQAPQARLPAPQVQAAPQVPTAPPATQVPAAPPAGPQVPQPVLPAPLSAPLSAPQAVHCPSIIWQAPKGQPPVPHEIPTSMEFQEVQQTQALAWQAQKAPTHIWQPLPAQEAQRQAPPLVQLEQPFQGAPPSQKAVQIQLPPQQAQASGPQAEVPTLPLQPSWQAPPAVLQAQPGPPVAAANFPLGSAKSLMTPSGECRASSIDRRGSSKERRTSSKERRAPSKDRMIFAATFCAPKAVSAARAHLPAAWKNLPATPETFAPSSSVFPATSQFQPASLNAFKGPSAASETPKSLPYALQDPFACVEALPAVPWVPQPNMNASKASQAVPTFLMATAAAPQATATTQEASKTSVEPPRRSGKATRKKKHLEAQEDSRGHTLAFHDWQGPRPWENLNLSDWEVQSPIQVSGDWEHPNTPRGLSGWEGPSTSRILSGWEGPSASWALSAWEGPSTSRALGLSESPGSSLPVVVSEVASVSPGSSATQDNSKVEAQPLSPLDERANALVQFLLVKDQAKVPVQRSEMVKVILREYKDECLDIINRANNKLECAFGYQLKEIDTKNHAYIIINKLGYHTGNLVASYLDRPKFGLLMVVLSLIFMKGNCVREDLIFNFLFKLGLDVRETNGLFGNTKKLITEVFVRQKYLEYRRIPYTEPAEYEFLWGPRAFLETSKMLVLRFLAKLHKKDPQSWPFHYLEALAECEWEDTDEDEPDTGDSAHGPTSRPPPR
"
misc_feature 3183..3695
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/note="MAGE family; Region: MAGE; pfam01454"
/db_xref="CDD:201804"
variation 1390
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233061"
variation 1408
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233062"
variation 1491
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="g"
/db_xref="dbSNP:2233063"
variation 1508
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="a"
/replace="c"
/db_xref="dbSNP:2233064"
variation 1550
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233065"
variation 2715
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="g"
/replace="t"
/db_xref="dbSNP:2233066"
variation 2737
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233067"
variation 2990
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233068"
variation 3150
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233069"
variation 3255
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="a"
/replace="c"
/db_xref="dbSNP:2233070"
variation 3333
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="c"
/replace="t"
/db_xref="dbSNP:2233071"
variation 3961
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="a"
/replace="c"
/db_xref="dbSNP:9785"
variation 4103
/gene="MAGEL2"
/gene_synonym="NDNL1; nM15"
/replace="a"
/replace="t"
/db_xref="dbSNP:8920"
ORIGIN
agggagggagcctctgaacagccacgtaggcattctcttctctctggaggaaaaggcccagcagctgtccgaggaaaagacccaccagctgtcagcaaagggacatgtcgcagctaagtaagaatctgggtgactcgagtcctccggcggaggccccgaagccgcctgtctatagccgccctacggttctgatgcgggccccgcccgcttcctcccgggctccgccagtcccttgggatccacctccaattgacttgcaggcttcattggccgcttggcaggcacctcagcctgcctgggaggccccacagggccagctgcccgccccggtggttccgatgacccagcctcctgccctagggggcccgatagtcccggctcccccgctggggggcccgatgggtaagcctccgactcccggggtcctgatggtgcatcctccacctccgggagccccgatggcccagcctccgaccccgggagtcctgatggtgcatccttcagctcccggagctcccatggcccatcctcctcctccggggaccccaatgtcccaccctccccctccggggaccccaatggcccatcctcctcctccggggaccccgatggcccatcctcctcctccggggaccccgatggtgcatcctcctcctccggggaccccgatggctcatcctccccctccggggacaccgatggctcatcctccccctccggggacaccgatggctcatcctccacctccggggacaccgatggctcatcctccccctccgggtacaccgatggcccagcctccagctccgggagtcctgatggcccagcctctgactccgggagtcctgatggtccagcctgctgctccgggagcaccgatggtccagccgcctccagcagccatgatgacccagcctcagccttcaggagcaccgatggccaagcctccaggtccaggagtcctgatgattcatcctccaggtgcgagagctccgatgacccagcctccagcttcaggagcaccgatggcacagccggcggccccacctgcacagccgatggccccacctgcacagccgatggcttcttgggccccgcaggctcagcctctgatcctgcaaatccagtctcaagttataagggctcctccgcaggttccccagggcccgcaggcacccccagcgcagctagccacacccccgggctggcaggcgacctcgccaggatggcaggccacgcagcaaggctggcaggccactcccctgacttggcagaccacgcaggtcacctggcaggcaccagccgttacctggcaggtgccgccgcccatgcgccaggggcccccgcccatccgccctggcccaccacccatccgccctggcccaccaccggtgcgacaggccccaccgctgatccgccaggccccaccggtgatccgccaggccccacccgtgatccgccaggccccacccgtgatccgccaggcccccgctgtgatccgccaggccccacctgtgatccgccaggccccacctgtgatccgccaggctccacctgtgatccgccaggccccgccgctgatccgccaggcgccgccgcccatccgacctgccccacaggtcctggccacccagccaccgctctggcaggccctgccacccccacctccactgcggcaggccccgcaggctaggctgccggccccgcaggtgcaggcggcgccgcaggtgcctacggccccacctgctacgcaggtacccgcggcgccgcccgctggcccgcaggtgccccagcctgtgctgccggccccgctgtctgccccactgtctgccccgcaggctgtgcactgcccttccatcatctggcaggcccccaaaggtcagcccccggtgccacacgagattccaacgtcaatggaattccaggaggtgcagcagacacaggcgctggcctggcaggcccagaaggcccccactcacatctggcagcccctgcctgcccaggaggcccagaggcaggctccccccttggtccagctggagcagccctttcagggagccccgccctcccaaaaagccgtgcaaatccagctacccccccagcaggcccaggcatcgggtccgcaagcggaggtgcccacactgccgctccagccttcctggcaggcaccgcctgcagtcttgcaggcccagcccggacccccggtagcagcggcaaattttcccctgggctccgctaaatcattgatgactccatcaggagaatgcagggcctcttctatagaccgcaggggctcctctaaagagcgcaggacctcctcgaaggagcgcagggccccttcaaaagaccgcatgatctttgctgccaccttctgtgctcccaaggcagtgtcagctgcgcgagcacacctgccagctgcctggaaaaacctgcctgccacaccggagacctttgctccctcctcaagtgtcttcccagctacctcccagtttcagcctgcctctctgaatgcctttaaaggcccctctgctgcctcagagaccccaaagtcactgccatatgctctgcaggatccctttgcctgtgtagaggccctgcctgcagttccatgggtcccacagcccaatatgaatgcctcaaaggcatcgcaggcagtgcccaccttcctgatggctacagcagctgccccccaggcaactgccaccactcaagaggcctccaagacctccgtcgagccgccacgccgctccggcaaggccacccggaagaagaagcatctggaagcccaagaggacagccgtggccacacgctagcctttcatgactggcagggcccaaggccctgggagaatctaaatctgagtgactgggaggtccaaagccctatccaggtctcgggtgactgggagcacccaaacaccccccgtggcctgagtggttgggagggccctagcacctccaggatcctgagtggctgggaagggcccagcgcatcctgggccctgagtgcctgggagggcccgagcacctccagggccctgggtctctctgaaagcccagggagctctctgcccgtagttgtgtctgaggtcgcaagtgtctctccgggatccagtgccacccaggataattccaaggtggaggcacagcccttgtctcccttggatgagagggcaaatgcgttggtgcagttcctcttagtcaaggaccaagccaaggtgcctgtccagcgctcggagatggtgaaagtcatcctccgagagtataaagatgagtgcttagatatcatcaaccgtgccaacaataagctggagtgtgcctttggttatcaattgaaagaaattgataccaaaaaccacgcctatattatcatcaacaagctgggctaccatacagggaatttggtggcatcctatttagacaggcccaagtttggccttctgatggtggtcttgagcctcatctttatgaaaggcaactgtgtcagggaggatctgatctttaattttctgttcaagttagggttggatgtccgggagacaaacggtctctttggaaatactaagaagctcatcaccgaagtgtttgtcaggcagaagtacctagagtacaggcgaatcccttacactgagcccgcagagtatgagttcctctggggccctcgagcattcctggaaaccagcaagatgcttgtcctgaggtttttggccaagctccataagaaagatccacagagctggccattccattaccttgaagcgctcgcagagtgtgagtgggaagacacagatgaggatgaacctgacaccggtgacagtgcccacggccccaccagcaggccccctccccgctaataggtgtagcagagatctcgctcctgtgtttccctggccagaggccactgacagggtggggggacatttttgttcctggtgtttgtgttccagttccacgagtgtacgtttggattttcaacttggtttcgtatctgccaaagctttgtacattttttatgtggtgttgatttcaatcggctactgttctgttctgtattttggcatctgtgtttttaagtgagatctgtggttctctgttttgtgttttaattgttatgttttggtatcagctttgtgctggctttgtgaaatgaattgagaagctatccatctcatttctggtatagttcatgtagcattgtaatcggttgttctttgaacgttcaaatgactcatcagtaaaaactgtctacagagaagtaaatatctatatctatatatataaatatactttcagcataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:54551 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
GeneID:54551 -> Biological process: GO:0008150 [biological_process] evidence: ND
GeneID:54551 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.