Home |
Help |
Advanced search
2026-01-17 09:25:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003585 2026 bp mRNA linear PRI 20-JUN-2013
DEFINITION Homo sapiens double C2-like domains, beta (DOC2B), mRNA.
ACCESSION NM_003585
VERSION NM_003585.4 GI:513788267
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2026)
AUTHORS Yao,J., Gaffaney,J.D., Kwon,S.E. and Chapman,E.R.
TITLE Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter
release
JOURNAL Cell 147 (3), 666-677 (2011)
PUBMED 22036572
REMARK GeneRIF: Study analyzed Doc2alpha and Doc2beta and found that Doc2
responds to changes in [Ca2+], with markedly slower kinetics as
compared to the cytosolic domain of syt I (syt), and operates on a
timescale consistent with asynchronous neurotransmitter release.
REFERENCE 2 (bases 1 to 2026)
AUTHORS Troyer,J.L., Nelson,G.W., Lautenberger,J.A., Chinn,L., McIntosh,C.,
Johnson,R.C., Sezgin,E., Kessing,B., Malasky,M., Hendrickson,S.L.,
Li,G., Pontius,J., Tang,M., An,P., Winkler,C.A., Limou,S., Le
Clerc,S., Delaneau,O., Zagury,J.F., Schuitemaker,H., van Manen,D.,
Bream,J.H., Gomperts,E.D., Buchbinder,S., Goedert,J.J., Kirk,G.D.
and O'Brien,S.J.
TITLE Genome-wide association study implicates PARD3B-based AIDS
restriction
JOURNAL J. Infect. Dis. 203 (10), 1491-1502 (2011)
PUBMED 21502085
REFERENCE 3 (bases 1 to 2026)
AUTHORS Cardoso,C., Leventer,R.J., Ward,H.L., Toyo-Oka,K., Chung,J.,
Gross,A., Martin,C.L., Allanson,J., Pilz,D.T., Olney,A.H.,
Mutchinick,O.M., Hirotsune,S., Wynshaw-Boris,A., Dobyns,W.B. and
Ledbetter,D.H.
TITLE Refinement of a 400-kb critical region allows genotypic
differentiation between isolated lissencephaly, Miller-Dieker
syndrome, and other phenotypes secondary to deletions of 17p13.3
JOURNAL Am. J. Hum. Genet. 72 (4), 918-930 (2003)
PUBMED 12621583
REFERENCE 4 (bases 1 to 2026)
AUTHORS Duncan,R.R., Betz,A., Shipston,M.J., Brose,N. and Chow,R.H.
TITLE Transient, phorbol ester-induced DOC2-Munc13 interactions in vivo
JOURNAL J. Biol. Chem. 274 (39), 27347-27350 (1999)
PUBMED 10488064
REMARK Erratum:[J Biol Chem 2000 Jan 21;275(3):2246]
REFERENCE 5 (bases 1 to 2026)
AUTHORS Nagano,F., Orita,S., Sasaki,T., Naito,A., Sakaguchi,G., Maeda,M.,
Watanabe,T., Kominami,E., Uchiyama,Y. and Takai,Y.
TITLE Interaction of Doc2 with tctex-1, a light chain of cytoplasmic
dynein. Implication in dynein-dependent vesicle transport
JOURNAL J. Biol. Chem. 273 (46), 30065-30068 (1998)
PUBMED 9804756
REFERENCE 6 (bases 1 to 2026)
AUTHORS Orita,S., Naito,A., Sakaguchi,G., Maeda,M., Igarashi,H., Sasaki,T.
and Takai,Y.
TITLE Physical and functional interactions of Doc2 and Munc13 in
Ca2+-dependent exocytotic machinery
JOURNAL J. Biol. Chem. 272 (26), 16081-16084 (1997)
PUBMED 9195900
REFERENCE 7 (bases 1 to 2026)
AUTHORS Verhage,M., de Vries,K.J., Roshol,H., Burbach,J.P., Gispen,W.H. and
Sudhof,T.C.
TITLE DOC2 proteins in rat brain: complementary distribution and proposed
function as vesicular adapter proteins in early stages of secretion
JOURNAL Neuron 18 (3), 453-461 (1997)
PUBMED 9115738
REFERENCE 8 (bases 1 to 2026)
AUTHORS Kojima,T., Fukuda,M., Aruga,J. and Mikoshiba,K.
TITLE Calcium-dependent phospholipid binding to the C2A domain of a
ubiquitous form of double C2 protein (Doc2 beta)
JOURNAL J. Biochem. 120 (3), 671-676 (1996)
PUBMED 8902635
REFERENCE 9 (bases 1 to 2026)
AUTHORS Sakaguchi,G., Orita,S., Maeda,M., Igarashi,H. and Takai,Y.
TITLE Molecular cloning of an isoform of Doc2 having two C2-like domains
JOURNAL Biochem. Biophys. Res. Commun. 217 (3), 1053-1061 (1995)
PUBMED 8554557
REFERENCE 10 (bases 1 to 2026)
AUTHORS Orita,S., Sasaki,T., Naito,A., Komuro,R., Ohtsuka,T., Maeda,M.,
Suzuki,H., Igarashi,H. and Takai,Y.
TITLE Doc2: a novel brain protein having two repeated C2-like domains
JOURNAL Biochem. Biophys. Res. Commun. 206 (2), 439-448 (1995)
PUBMED 7826360
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from D70830.1 and AI478508.1.
On Jun 20, 2013 this sequence version replaced gi:295054131.
Summary: There are at least two protein isoforms of the Double C2
protein, namely alpha (DOC2A) and beta (DOC2B), which contain two
C2-like domains. DOC2A and DOC2B are encoded by different genes;
these genes are at times confused with the unrelated DAB2 gene
which was initially named DOC-2. DOC2B is expressed ubiquitously
and is suggested to be involved in Ca(2+)-dependent intracellular
vesicle trafficking in various types of cells. [provided by RefSeq,
Jul 2008].
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-890 D70830.1 10-899
891-896 AI478508.1 409-414
897-1702 D70830.1 906-1711
1703-2023 D70830.1 1713-2033
2024-2026 D70830.1 2037-2039
FEATURES Location/Qualifiers
source 1..2026
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17p13.3"
gene 1..2026
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="double C2-like domains, beta"
/db_xref="GeneID:8447"
/db_xref="HGNC:2986"
/db_xref="MIM:604568"
exon 1..524
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
misc_feature 86..88
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="upstream in-frame stop codon"
STS 102..1440
/gene="DOC2B"
/gene_synonym="DOC2BL"
/db_xref="UniSTS:481194"
CDS 152..1390
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="doc2-beta"
/codon_start=1
/product="double C2-like domain-containing protein beta"
/protein_id="NP_003576.2"
/db_xref="GI:295054132"
/db_xref="GeneID:8447"
/db_xref="HGNC:2986"
/db_xref="MIM:604568"
/translation="
MTLRRRGEKATISIQEHMAIDVCPGPIRPIKQISDYFPRFPRGLPPDAGPRAAAPPDAPARPAVAGAGRRSPSDGAREDDEDVDQLFGAYGSSPGPSPGPSPARPPAKPPEDEPDADGYESDDCTALGTLDFSLLYDQENNALHCTITKAKGLKPMDHNGLADPYVKLHLLPGASKANKLRTKTLRNTLNPTWNETLTYYGITDEDMIRKTLRISVCDEDKFRHNEFIGETRVPLKKLKPNHTKTFSICLEKQLPVDKTEDKSLEERGRILISLKYSSQKQGLLVGIVRCAHLAAMDANGYSDPYVKTYLRPDVDKKSKHKTAVKKKTLNPEFNEEFCYEIKHGDLAKKSLEVTVWDYDIGKSNDFIGGVVLGIHAKGERLKHWFDCLKNKDKRIERWHTLTSELPGAVLSD
"
misc_feature 152..421
/gene="DOC2B"
/gene_synonym="DOC2BL"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14184.1);
Region: Mediates interaction with DYNLT1"
misc_feature 152..259
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14184.1);
Region: Negatively regulates targeting to plasma membrane
(By similarity)"
misc_feature 530..901
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="C2 domain first repeat present in Rabphilin and
Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
/db_xref="CDD:176000"
misc_feature order(620..622,638..640,803..805,809..811,827..829)
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:176000"
misc_feature 920..1276
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q14184.1);
Region: Mediates interaction with STXBP3 (By similarity)"
misc_feature 956..1354
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="C2 domain second repeat present in Rabphilin and
Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
/db_xref="CDD:176030"
misc_feature order(1040..1042,1058..1060,1220..1222,1226..1228,
1244..1246)
/gene="DOC2B"
/gene_synonym="DOC2BL"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:176030"
exon 525..604
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 605..679
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 680..789
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 790..916
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 917..1074
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 1075..1156
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 1157..1253
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
exon 1254..2026
/gene="DOC2B"
/gene_synonym="DOC2BL"
/inference="alignment:Splign:1.39.8"
STS 1401..1649
/gene="DOC2B"
/gene_synonym="DOC2BL"
/standard_name="RH80768"
/db_xref="UniSTS:87013"
STS 1679..1873
/gene="DOC2B"
/gene_synonym="DOC2BL"
/standard_name="STS-D70830"
/db_xref="UniSTS:73663"
ORIGIN
gcggagcgggcagcggccaagtcagggccgtccgggggcgcggccggcgatgcccgcagcccccgccgcgccccgccgggcctgctgagccgcccccgggccggggtcgcgccgggccgggccgcgcccggggcggggcggcgctgcctgcatgaccctccggcggcgcggggagaaggcgaccatcagcatccaggagcatatggccatcgacgtgtgccccggccccatccgtcccatcaagcagatctccgactacttcccccgcttcccgcggggcctgcccccggacgccgggccccgagccgctgcacccccggacgcccccgcgcgcccggctgtggccggtgccggccgccgcagcccctccgacggcgcccgcgaggacgacgaggatgtggaccagctcttcggagcctacggctccagcccgggccccagcccgggtcccagccccgcgcggccgccagccaagccgccggaggacgagccggacgccgacggctacgagtcggacgactgcactgccctgggcacgctggacttcagcctgctgtatgaccaggagaacaacgccctccactgcaccatcaccaaggccaagggcctgaagccaatggaccacaatgggctggcagacccctacgtcaagctgcacctgctgccaggagccagtaaggcaaataagctcagaacaaaaactctccgtaacactctgaaccccacatggaacgagaccctcacttactacgggatcacagatgaagacatgatccgcaagaccctgcggatctctgtgtgtgacgaggacaaattccggcacaatgagttcatcggggagacacgtgtgcccctgaagaagctgaaacccaaccacaccaagaccttcagcatctgcctggagaagcagctgccggtggacaagactgaagacaagtccctggaggagcggggccgcatcctcatctccctcaagtacagctcacagaagcaaggcctgctggtaggcatcgtgcggtgcgcccacctggccgccatggacgccaacggctactcggacccctacgtgaaaacatacctgaggccagatgtggacaagaaatccaaacataagacagcggtgaagaaaaaaaccctgaacccggagtttaatgaggagttctgttacgagatcaagcatggggacctggccaagaagtccctggaggtcaccgtttgggattacgacattggaaaatccaacgatttcattggtggtgtggttctgggcatccacgccaagggggagcgcctgaagcactggtttgactgcctgaagaacaaggacaagcgcatcgagcgctggcacacgctcaccagcgagctcccaggggctgtgctcagcgactgacgcccacccgccactgctacccctgccgccacctgcgcccagcacggccggccccgggcttccccagcagccaccaaggcctgtggcccccacactgggggagatccagaacccctgcttggacacagagccactgcagtccccgctcggaggatgtggagggctcagccactctgggacggggagggcaaggagctggggtggggggctctcagctctctggggcccaagaggccggtggtggaaagagacctcagcacctgcccaggggaaggggacacgcccatctgggagcaaagacccttctagaggccagccccggctgagaggacaggagtgtgggggcgccttggcggacagtgggaacagaggagggaggtggtgagcagacagacaggtggaggatgggaccttgaagactggctgctccagcccaagaaagcctaactgcatccctcatctccttcgctgctggacagatggaagaagcgggcctgccggccgaaagtctgccagagttcccggaggctcctgatgatgggtaaattggcacatgcttcactcaatgattccacaagccctgggggtgaatgagacacagggcctgccctcagggagttcccatctagtcaggaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:8447 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA
GeneID:8447 -> Molecular function: GO:0005544 [calcium-dependent phospholipid binding] evidence: ISS
GeneID:8447 -> Molecular function: GO:0019905 [syntaxin binding] evidence: IEA
GeneID:8447 -> Biological process: GO:0008104 [protein localization] evidence: ISS
GeneID:8447 -> Biological process: GO:0031340 [positive regulation of vesicle fusion] evidence: ISS
GeneID:8447 -> Biological process: GO:0032024 [positive regulation of insulin secretion] evidence: ISS
GeneID:8447 -> Biological process: GO:0045956 [positive regulation of calcium ion-dependent exocytosis] evidence: ISS
GeneID:8447 -> Biological process: GO:0048791 [calcium ion-dependent exocytosis of neurotransmitter] evidence: ISS
GeneID:8447 -> Cellular component: GO:0005737 [cytoplasm] evidence: ISS
GeneID:8447 -> Cellular component: GO:0005886 [plasma membrane] evidence: ISS
GeneID:8447 -> Cellular component: GO:0008021 [synaptic vesicle] evidence: IEA
GeneID:8447 -> Cellular component: GO:0015630 [microtubule cytoskeleton] evidence: IDA
GeneID:8447 -> Cellular component: GO:0031201 [SNARE complex] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.