GGRNA Home | Help | Advanced search

2025-05-09 19:13:56, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_003960959            1383 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens double homeobox 4 like 7 (DUX4L7), mRNA.
ACCESSION   XM_003960959
VERSION     XM_003960959.1  GI:410170266
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001841507) annotated using gene prediction method: GNOMON.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1383
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Unknown"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..1383
                     /gene="DUX4L7"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 4 Proteins"
                     /db_xref="GeneID:653543"
                     /db_xref="HGNC:37266"
     CDS             1..1383
                     /gene="DUX4L7"
                     /codon_start=1
                     /product="LOW QUALITY PROTEIN: double homeobox 4 like 7"
                     /protein_id="XP_003961008.1"
                     /db_xref="GI:410170267"
                     /db_xref="GeneID:653543"
                     /db_xref="HGNC:37266"
                     /translation="
MQGMVEDRHVHRPAEVHGSPPTSLCPCPSVKFRPGLPAMALLTPSHSTLPAESQGWERQRRLIWTPSKSEALQACFERNPYPGITTRERLAQAIGIQEPRVQIWFQNERSCQLRQHWRVSRPWPGRRGLQEGRRKRTAVTGSQTVLLLRAVAKDRFPGIAAREELAGKTGVLESRIQIWFQNRRARHPGQAGRAPTQAGGRCNAAPIGCHPAPSWVAFAHTGTWGMWLPAPHVPCVPGALPQGAFMSQGARVVPVLQPSQATPAEGISQPAPARGDLAYAAPAPPEGALSHTQVPRWPPHPGKIWEDRDPQHDGLPDPCLVGYPGPAQAGPQGQGVLAPPASQGSPWWGWGRGSQVAGAAWEPQAGAAPPLQPTPPEASTQQGQMQGMPASSQALQEPGRSSALPSGLLLDELLANPEFLQQAQPFIETDALGELEALEEAASLKXPFSEEEYQTLLEEL
"
     misc_feature    172..348
                     /gene="DUX4L7"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(172..186,190..192,241..243,259..261,298..300,
                     304..309,316..321,325..333,337..342)
                     /gene="DUX4L7"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(178..180,187..189,307..309,316..321,328..330)
                     /gene="DUX4L7"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    397..561
                     /gene="DUX4L7"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(397..411,415..417,466..468,484..486,523..525,
                     529..534,541..546,550..558)
                     /gene="DUX4L7"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(403..405,412..414,532..534,541..546,553..555)
                     /gene="DUX4L7"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       109
                     /gene="DUX4L7"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371361094"
     variation       138
                     /gene="DUX4L7"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376803527"
ORIGIN      
atgcagggaatggtggaagaccggcatgtgcacaggccagctgaggtgcacgggagcccgccgacctctctctgcccatgtccgtctgtgaaattccggccggggctgcccgcgatggccctcctgactccttcgcacagcaccctccctgcggaatcccagggatgggaacggcaaaggagactcatttggaccccgagcaaaagcgaggccctacaagcctgctttgaacggaacccgtacccgggcatcaccaccagagaacggctggcccaggccatcggcattcaggagcccagggtccagatttggtttcagaatgagaggtcatgccagctgaggcagcactggcgggtatctcggccctggcccgggagacgtggcctgcaagaaggcaggcgaaagcggaccgccgtcaccggatcccagaccgtcctgctactccgagccgttgcgaaggatcgctttccaggcattgccgccagggaagagctggccggaaagacgggagtcctggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacaggctggaagggcgcccacgcaggcaggcggccggtgcaacgcagcccccattgggtgtcaccctgctccctcgtgggtcgcctttgcccacaccggcacttggggaatgtggcttcctgcaccccacgtgccctgcgtgcctggggctctcccacagggggctttcatgagccaaggagcgagggtcgtccccgtgctccagcccagccaggccacaccggcagaggggatctcccaacctgccccagcacgcggggatcttgcctacgccgccccggctcccccggaaggggcgctctcccacactcaggttcctcggtggcctccgcacccgggcaaaatctgggaggaccgggacccgcagcacgacggcctgccggatccttgcttggtgggatatcctgggcccgctcaagcggggccacagggccaaggtgtgcttgcaccacccgcgtcacaggggagtccgtggtggggctggggccggggttcccaggtcgctggggcggcatgggaaccccaagccggggcagctccacctctccagcccacgcccccggaggcctccacgcagcaggggcagatgcaaggcatgccggcgtcctcccaggcgctccaggagccggggcgatcgtctgcactcccctccggcctgctgctggatgagctcctggcaaacccggagtttctgcagcaggcacaacctttcatagaaacggatgccctgggggagctggaagccttggaagaggctgcttccctgaagncaccctttagtgaggaagaataccagactctgctggaggagctctag
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:653543 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA
            GeneID:653543 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:653543 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:653543 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.