2025-05-09 19:03:36, GGRNA : RefSeq release 60 (20130726)
LOCUS XM_003846749 1275 bp mRNA linear PRI 30-OCT-2012 DEFINITION PREDICTED: Homo sapiens double homeobox protein 4-like protein 2-like (LOC100292669), mRNA. ACCESSION XM_003846749 VERSION XM_003846749.2 GI:410170260 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_001841145) annotated using gene prediction method: GNOMON. Also see: Documentation of NCBI's Annotation Process On Oct 30, 2012 this sequence version replaced gi:397138635. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1275 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Unknown" /sex="male" /dev_stage="adult" gene 1..1275 /gene="LOC100292669" /note="Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:100292669" CDS 1..1275 /gene="LOC100292669" /codon_start=1 /product="double homeobox protein 4-like protein 2-like" /protein_id="XP_003846797.2" /db_xref="GI:410170261" /db_xref="GeneID:100292669" /translation="
MATPTGTASFTERGPGTLNAPMEVHRPAEVHGSPPATLCPCPSVKFRPGLPAMALPTPSDSTLTAEARGRRGRRRLVWTPSQSEALRAFFERNPYPGIPTRERLAQATGILEPKVQIWFQNERSRQLRKRRRESRPWPGRRGPQEGRQKRTTVTGSQTAPLLRAFEKDHYPGIATREELARETGLPESRIQIWFQNPRARHPGQGGRTNTQAGGLCNATPRGCHPAPSWVAFVHTGAWGTGLCAPHVPCVPGALPLGLSCARERGPSLSSSPARPLRLRGSPNWPRHAGILPTPPRLFRKGRSPTLRLLGGLHTWAKAGKTGPSSAMACQALVWWEWLGPLKWGHRAKVCLRHPRPGESVVELGPGSPGRRGGMGTRSQGSSTSPASAPGGLPVAGADARHPGALPGAPGSGALVCTPLRPAAG
" misc_feature 229..363 /gene="LOC100292669" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(229..231,349..351,358..363) /gene="LOC100292669" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 439..603 /gene="LOC100292669" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(439..453,457..459,508..510,526..528,565..567, 571..576,583..588,592..600) /gene="LOC100292669" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(445..447,454..456,574..576,583..588,595..597) /gene="LOC100292669" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" ORIGIN
atggcgacaccgacaggcactgcctccttcacggagagagggccgggaacactcaatgctcccatggaggtgcacaggccggctgaggtgcatgggagtccgccggccactctctgcccgtgtccgtccgtgaaattccggccagggctccccgcgatggccctcccgacaccttcggacagcaccctcaccgcggaagcccggggacggagagggcgaaggagactcgtttggaccccgagccaaagcgaggccctgcgagccttctttgagcggaacccatacccaggcatccctacccgagaacggctggcccaggccaccggcattctggagccaaaggtccagatttggtttcagaatgagaggtcacgtcagctgaggaagcgccggagggaatctcggccctggcccgggagacgtggcccacaagaaggcaggcaaaagcggaccaccgtcaccggatcccagaccgcccccctcctccgagcctttgagaaggatcactatccaggcatcgccaccagggaagagctggccagagagacgggcctcccagagtccaggattcagatctggtttcagaatccaagggccaggcacccgggacagggtggcaggacgaacacgcaggcaggcggcctgtgcaacgcgacaccccgcgggtgtcaccctgctccctcgtgggttgccttcgtccacaccggcgcgtggggaacggggctttgcgcaccccacgtgccctgcgtgcctggggctctcccactggggctttcatgtgccagggagcgagggccgtccctgtcctccagcccggccaggccgctccggctgaggggatctcccaactggccacgacatgcggggattttgcctacgccacccaggctcttccggaaggggcgctctcccaccctcaggctcctcggtggcctccacacctgggcaaaagccgggaagactgggcccagcagcgcgatggcctgccaggcccttgtgtggtgggagtggctgggcccgctcaagtggggccacagggccaaggtgtgcttgcgccacccgcgtccaggtgagtccgtggtggagctggggcccgggtccccaggtcgccgtggcggcatgggaacccgaagccagggcagctccacctcgccagccagcgcccccggaggcctccccgtggcaggggcagatgcaaggcatcccggtgccctccctggcgctccaggatccggggcactcgtctgcactcccctccggcctgctgctggatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.