GGRNA Home | Help | Advanced search

2025-05-09 19:02:46, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_003846458            1698 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens double homeobox protein 4-like
            (LOC100288494), mRNA.
ACCESSION   XM_003846458
VERSION     XM_003846458.1  GI:397139876
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NT_167222) annotated using gene prediction method: GNOMON.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1698
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Unknown"
     gene            1..1698
                     /gene="LOC100288494"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 6 Proteins"
                     /db_xref="GeneID:100288494"
     CDS             1..1698
                     /gene="LOC100288494"
                     /codon_start=1
                     /product="double homeobox protein 4-like"
                     /protein_id="XP_003846506.1"
                     /db_xref="GI:397139877"
                     /db_xref="GeneID:100288494"
                     /translation="
MVPSLSLPGSKPATLQTPHVAARGNPSSGHHAGEASPLWGLALVFYVEMNESHTPACWFLPAADAWEPRERLPVPAGSLERGGACLPVGLYKGGWLAGWLAVRAGLLAAPAAVHSPAEVHGSPPASLCPRPSVKFRPGLTAMALPTPSDSTLPAEARGRGRRRRLVWTPSQSEALRACFERNPYPGIATRERLAQAIGIPEPRVQIWFQNERSRQLRQHRRESRPWPGRRGPPEGRRKRTAVTGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHPGQGGRAPAQAGGLCSAAPGGGHPAPSWVAFAHTGAWGTGLPAPHVPCAPGALPQGAFVSQAARAAPALQPSQAAPAEGISQPAPARGDFAYAAPAPPDGALSHPQAPRWPPHPGKSREDRDPQRDGLPGPCAVAQPGPAQAGPQGQGVLAPPTSQGSPWWGWGRGPQVAGAAWEPQAGAAPPPQPAPPDASASARQGQMQGIPAPSQALQEPAPWSALPCGLLLDELLASPEFLQQAQPLLETEAPGELEASEEAASLEAPLSEEEYRALLEEL
"
     misc_feature    496..657
                     /gene="LOC100288494"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(496..498,616..618,625..630,637..639)
                     /gene="LOC100288494"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    order(499..501,550..552,568..570,607..609,613..618,
                     625..630,634..642,646..651)
                     /gene="LOC100288494"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    718..870
                     /gene="LOC100288494"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(718..720,724..726,775..777,793..795,832..834,
                     838..843,850..855,859..867)
                     /gene="LOC100288494"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(721..723,841..843,850..855,862..864)
                     /gene="LOC100288494"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
ORIGIN      
atggtgccttcgctctccttgccaggttccaaaccggccacactgcagactccccacgttgccgcacgcgggaatccatcgtcaggccatcacgccggggaggcatctcctctctggggtctcgctctggtcttctacgtggaaatgaacgagagccacacgcctgcgtgctggtttctccctgctgccgacgcgtgggagcccagagagcggcttcccgttcccgcgggatccctggagaggggtggagcctgcctgcctgtgggcctttacaagggcggctggctggctggctggctggctgtccgggcaggcctcctggctgcacctgccgcagtgcacagtccggctgaggtgcacgggagcccgccggcctctctctgcccgcgtccgtccgtgaaattccggccggggctcaccgcgatggccctcccgacaccctcggacagcaccctccccgcggaagcccggggacgaggacggcgacggagactcgtttggaccccgagccaaagcgaggccctgcgagcctgctttgagcggaacccgtacccgggcatcgccaccagagaacggctggcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaggcagcaccggcgggaatctcggccctggcccgggagacgcggcccgccagaaggccggcgaaagcggaccgccgtcaccggatcccagaccgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccgcccgggaggagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacagggtggcagggcgcccgcgcaggcaggcggcctgtgcagcgcggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagaggggatctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcacccgggcaaaagccgggaggaccgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttag
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.