Home |
Help |
Advanced search
2025-05-09 20:30:50, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_047517 2370 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens HOX transcript antisense RNA (HOTAIR), transcript
variant 1, non-coding RNA.
ACCESSION NR_047517
VERSION NR_047517.1 GI:383286742
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2370)
AUTHORS Kim,K., Jutooru,I., Chadalapaka,G., Johnson,G., Frank,J.,
Burghardt,R., Kim,S. and Safe,S.
TITLE HOTAIR is a negative prognostic factor and exhibits pro-oncogenic
activity in pancreatic cancer
JOURNAL Oncogene 32 (13), 1616-1625 (2013)
PUBMED 22614017
REMARK GeneRIF: HOTAIR is a negative prognostic factor and exhibits
pro-oncogenic activity in pancreatic cancer.
REFERENCE 2 (bases 1 to 2370)
AUTHORS Li,D., Feng,J., Wu,T., Wang,Y., Sun,Y., Ren,J. and Liu,M.
TITLE Long intergenic noncoding RNA HOTAIR is overexpressed and regulates
PTEN methylation in laryngeal squamous cell carcinoma
JOURNAL Am. J. Pathol. 182 (1), 64-70 (2013)
PUBMED 23141928
REMARK GeneRIF: HOTAIR is overexpressed and regulates PTEN methylation in
laryngeal squamous cell carcinoma.
REFERENCE 3 (bases 1 to 2370)
AUTHORS Lu,L., Zhu,G., Zhang,C., Deng,Q., Katsaros,D., Mayne,S.T.,
Risch,H.A., Mu,L., Canuto,E.M., Gregori,G., Benedetto,C. and Yu,H.
TITLE Association of large noncoding RNA HOTAIR expression and its
downstream intergenic CpG island methylation with survival in
breast cancer
JOURNAL Breast Cancer Res. Treat. 136 (3), 875-883 (2012)
PUBMED 23124417
REMARK GeneRIF: intergenic DNA methylation may have important biologic
relevance in regulating HOTAIR expression
REFERENCE 4 (bases 1 to 2370)
AUTHORS Pauler,F.M., Barlow,D.P. and Hudson,Q.J.
TITLE Mechanisms of long range silencing by imprinted macro non-coding
RNAs
JOURNAL Curr. Opin. Genet. Dev. 22 (3), 283-289 (2012)
PUBMED 22386265
REMARK Review article
REFERENCE 5 (bases 1 to 2370)
AUTHORS Niland,C.N., Merry,C.R. and Khalil,A.M.
TITLE Emerging Roles for Long Non-Coding RNAs in Cancer and Neurological
Disorders
JOURNAL Front Genet 3, 25 (2012)
PUBMED 22375145
REFERENCE 6 (bases 1 to 2370)
AUTHORS Tsai,M.C., Manor,O., Wan,Y., Mosammaparast,N., Wang,J.K., Lan,F.,
Shi,Y., Segal,E. and Chang,H.Y.
TITLE Long noncoding RNA as modular scaffold of histone modification
complexes
JOURNAL Science 329 (5992), 689-693 (2010)
PUBMED 20616235
REMARK GeneRIF: findings show that the lincRNA HOTAIR serves as a scaffold
for at least two distinct histone modification complexes; A 5'
domain of HOTAIR binds polycomb repressive complex 2 (PRC2),
whereas a 3' domain of HOTAIR binds the LSD1/CoREST/REST complex
REFERENCE 7 (bases 1 to 2370)
AUTHORS Gupta,R.A., Shah,N., Wang,K.C., Kim,J., Horlings,H.M., Wong,D.J.,
Tsai,M.C., Hung,T., Argani,P., Rinn,J.L., Wang,Y., Brzoska,P.,
Kong,B., Li,R., West,R.B., van de Vijver,M.J., Sukumar,S. and
Chang,H.Y.
TITLE Long non-coding RNA HOTAIR reprograms chromatin state to promote
cancer metastasis
JOURNAL Nature 464 (7291), 1071-1076 (2010)
PUBMED 20393566
REMARK GeneRIF: The lincRNA termed HOTAIR is increased in expression in
primary breast tumours and metastases, and HOTAIR expression level
in primary tumours is a powerful predictor of eventual metastasis
and death.
REFERENCE 8 (bases 1 to 2370)
AUTHORS Khalil,A.M., Guttman,M., Huarte,M., Garber,M., Raj,A., Rivea
Morales,D., Thomas,K., Presser,A., Bernstein,B.E., van
Oudenaarden,A., Regev,A., Lander,E.S. and Rinn,J.L.
TITLE Many human large intergenic noncoding RNAs associate with
chromatin-modifying complexes and affect gene expression
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 106 (28), 11667-11672 (2009)
PUBMED 19571010
REFERENCE 9 (bases 1 to 2370)
AUTHORS Rinn,J.L., Kertesz,M., Wang,J.K., Squazzo,S.L., Xu,X.,
Brugmann,S.A., Goodnough,L.H., Helms,J.A., Farnham,P.J., Segal,E.
and Chang,H.Y.
TITLE Functional demarcation of active and silent chromatin domains in
human HOX loci by noncoding RNAs
JOURNAL Cell 129 (7), 1311-1323 (2007)
PUBMED 17604720
REFERENCE 10 (bases 1 to 2370)
AUTHORS Woo,C.J. and Kingston,R.E.
TITLE HOTAIR lifts noncoding RNAs to new levels
JOURNAL Cell 129 (7), 1257-1259 (2007)
PUBMED 17604716
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA905601.1, AC012531.11 and
AA399272.1.
Summary: This gene is located within the Homeobox C (HOXC) gene
cluster on chromosome 12 and is co-expressed with HOXC genes. It
represses transcription of HOXD genes on chromosome 2 in trans.
This gene is shuttled from chromosome 12 to chromosome 2 by a
component of Polycomb Repressive Complex 2 (PRC2). This gene
interacts with both PRC2 and lysine specific demethylase 1 (LSD1)
complexes through its 5' and 3' domains, respectively, and serves
as a scaffold to assemble PRC2 and LSD1 complexes to the HOXD gene
cluster. It couples H3K27 methylation and H3K4 demethylation for
epigenetic silencing of HOXD genes in multiple tissues. This gene
is highly expressed in multiple tumors. Alternatively spliced
transcript variants have been identified. [provided by RefSeq, Feb
2013].
Transcript Variant: This variant (1) consists of six exons.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: DA905601.1, DA906831.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025088 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-560 DA905601.1 1-560
561-2223 AC012531.11 100057-101719 c
2224-2370 AA399272.1 1-147 c
FEATURES Location/Qualifiers
source 1..2370
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="12"
/map="12q13.13"
gene 1..2370
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/note="HOX transcript antisense RNA"
/db_xref="GeneID:100124700"
/db_xref="HGNC:33510"
/db_xref="MIM:611400"
misc_RNA 1..2370
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/product="HOX transcript antisense RNA, transcript variant
1"
/db_xref="GeneID:100124700"
/db_xref="HGNC:33510"
/db_xref="MIM:611400"
exon 1..59
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/inference="alignment:Splign:1.39.8"
exon 60..199
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/inference="alignment:Splign:1.39.8"
exon 200..325
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/inference="alignment:Splign:1.39.8"
exon 326..427
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/inference="alignment:Splign:1.39.8"
exon 428..551
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/inference="alignment:Splign:1.39.8"
exon 552..2368
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/inference="alignment:Splign:1.39.8"
variation 965
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/replace="c"
/replace="g"
/db_xref="dbSNP:1838169"
variation 2008
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
/replace=""
/replace="c"
/db_xref="dbSNP:3839968"
polyA_signal 2342..2347
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
polyA_site 2368
/gene="HOTAIR"
/gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
ORIGIN
ccagttctcaggcgagagccgcggctgacagggtctgggacagaaggaaagccctccagcctccaggccctgccttctgcctgcacattctgccctgatttccggaacctggaagcctaggcaggcagtggggaactctgactcgcctgtgctctggagcttgatccgaaagcttccacagtgaggactgctccgtgggggtaagagagcaccaggcactgaggcctgggagttccacagaccaacacccctgctcctggcggctcccacccgggacttagaccctcaggtccctaatatcccggaggtgctctcaatcagaaaggtcctgctccgcttcgcagtggaatggaacggatttagaagcctgcagtaggggagtggggagtggagagagggagcccagagttacagacggcggcgagaggaaggaggggcgtctttatttttttaaggccccaaagagtctgatgtttacaagaccagaaatgccacggccgcgtcctggcagagaaaaggctgaaatggaggaccggcgccttccttataagctcgttggggcctaagccagtaccgacctggtagaaaaagcaaccacgaagctagagagagagccagaggagggaagagagcgccagacgaaggtgaaagcgaaccacgcagagaaatgcaggcaagggagcaaggcggcagttcccggaacaaacgtggcagagggcaagacgggcactcacagacagaggtttatgtatttttattttttaaaatctgatttggtgttccatgaggaaaagggaaaatctagggaacgggagtacagagagaataatccgggtcctagctcgccacatgaacgcccagagaacgctggaaaaacctgagcgggtgccggggcagcacccggctcgggtcagccactgccccacaccgggcccaccaagccccgcccctcgcggccaccggggcttccttgctcttcttatcatctccatctttatgatgaggcttgttaacaagaccagagagctggccaagcacctctatctcagccgcgcccgctcagccgagcagcggtcggtggggggactgggaggcgctaattaattgattcctttggactgtaaaatatggcggcgtctacacggaacccatggactcataaacaatatatctgttgggcgtgagtgcactgtctctcaaataatttttccataggcaaatgtcagagggttctggatttttagttgctaaggaaagatccaaatgggaccaattttaggaggcccaaacagagtccgttcagtgtcagaaaatgcttccccaaaggggttgggagtgtgttttgttggaaaaaagcttgggttataggaaagcctttccctgctacttgtgtagacccagcccaatttaagaattacaaggaagcgaaggggttgtgtaggccggaagcctctctgtcccggctggatgcaggggacttgagctgctccggaatttgagaggaacatagaagcaaaggtccagcctttgcttcgtgctgattcctagacttaagattcaaaaacaaatttttaaaagtgaaaccagccctagcctttggaagctcttgaaggttcagcacccacccaggaatccacctgcctgttacacgcctctccaagacacagtggcaccgcttttctaactggcagcacagagcaactctataatatgcttatattaggtctagaagaatgcatcttgagacacatgggtaacctaattatataatgcttgttccatacaggagtgattatgcagtgggaccctgctgcaaacgggactttgcactctaaatatagaccccagcttgggacaaaagttgcagtagaaaaatagacataggagaacacttaaataagtgatgcatgtagacacagaaggggtatttaaaagacagaaataatagaagtacagaagaacagaaaaaaaatcagcagatggagattaccattcccaatgcctgaacttcctcctgctattaagattgctagagaattgtgtcttaaacagttcatgaacccagaagaatgcaatttcaatgtatttagtacacacacagtatgtatataaacacaactcacagaatatattttccatacattgggtaggtatgcactttgtgtatatataataatgtattttccatgcagttttaaaatgtagatatattaatatctggatgcattttctgtgcactggttttatatgccttatggagtatatactcacatgtagctaaatagactcaggactgcacattccttgtgtaggttgtgtgtgtgtggtggttttatgcataaataaagttttacatgtggtgaatataaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.