GGRNA Home | Help | Advanced search

2025-05-09 20:14:37, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_036440               1084 bp    RNA     linear   PRI 16-JUL-2013
DEFINITION  Homo sapiens POU class 5 homeobox 1 pseudogene 3 (POU5F1P3),
            non-coding RNA.
ACCESSION   NR_036440
VERSION     NR_036440.1  GI:301601612
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1084)
  AUTHORS   Suo,G., Han,J., Wang,X., Zhang,J., Zhao,Y., Zhao,Y. and Dai,J.
  TITLE     Oct4 pseudogenes are transcribed in cancers
  JOURNAL   Biochem. Biophys. Res. Commun. 337 (4), 1047-1051 (2005)
   PUBMED   16229821
REFERENCE   2  (bases 1 to 1084)
  AUTHORS   Wey,E., Lyons,G.E. and Schafer,B.W.
  TITLE     A human POU domain gene, mPOU, is expressed in developing brain and
            specific adult tissues
  JOURNAL   Eur. J. Biochem. 220 (3), 753-762 (1994)
   PUBMED   7908264
REFERENCE   3  (bases 1 to 1084)
  AUTHORS   Guillaudeux,T., Mattei,M.G., Depetris,D., Le Bouteiller,P. and
            Pontarotti,P.
  TITLE     In situ hybridization localizes the human OTF3 to chromosome
            6p21.3-->p22 and OTF3L to 12p13
  JOURNAL   Cytogenet. Cell Genet. 63 (4), 212-214 (1993)
   PUBMED   8500351
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            GU480907.1 and AC092111.9.
            
            ##Evidence-Data-START##
            Transcript is intronless :: GU480832.1, GU480837.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-400               GU480907.1         1-400
            401-401             AC092111.9         6027-6027           c
            402-686             GU480907.1         402-686
            687-687             AC092111.9         5741-5741           c
            688-1084            GU480907.1         688-1084
FEATURES             Location/Qualifiers
     source          1..1084
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13.31"
     gene            1..1084
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /note="POU class 5 homeobox 1 pseudogene 3"
                     /pseudo
                     /db_xref="GeneID:642559"
                     /db_xref="HGNC:9222"
     misc_RNA        1..1084
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /product="POU class 5 homeobox 1 pseudogene 3"
                     /pseudo
                     /db_xref="GeneID:642559"
                     /db_xref="HGNC:9222"
     exon            1..1084
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(48)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189325356"
     variation       complement(50)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144623077"
     variation       complement(69)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376132895"
     variation       complement(148)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183826740"
     variation       complement(194)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377004588"
     variation       complement(264)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373996484"
     variation       complement(323)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191232266"
     variation       complement(401)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11043498"
     variation       complement(523)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190024572"
     variation       complement(578)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140763884"
     variation       complement(606)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184698496"
     variation       complement(656)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193186392"
     variation       complement(678)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111592684"
     variation       complement(683)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111886055"
     variation       complement(687)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7315526"
     variation       complement(798)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374144237"
     variation       complement(963..964)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:61642531"
     variation       complement(967..968)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:367900744"
     variation       complement(1022)
                     /gene="POU5F1P3"
                     /gene_synonym="OTF3L; POU5F1L; POU5FLC12"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200565509"
ORIGIN      


catggcgggacacctggcttcggatttcgccttctcaccccctccaggcggtggaggtgatgggccaggggggccggagccgggctgggttgatcctcggacctggctaagcttccaaggccctcctggagggccaggaatcgggccggggtttgggccaggctctgaggagtgggggattcccccatgtcccccgccgtatgagttctgcggggggatggcgtactgtgggcctcagactggagtggggctagtgccccaagacggcttggagacctctcagcctgagggcgaagcaggagtcggggtggagagcaactccgatggggcctccccggagccctgcaccgtcccctctggtgccgtgaagctggagaaggagaagctggagcaaaacccggaggagtcccaggacatcaaagctctgcagaaagaactcgagcaatttgccaagctcctgaagcagaagaggatcaccctgggatatacacaggccgatgtggctcaccctgggggttctatttgggaaggtgttcagccaaacgaccatctgccgctttgaggctctgcagcttagcttcaagaacatgtgtgagctgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaatcttcaggagatatgcaaagcagaaaccctcgtgcaggcccgaaagagaaagcgaaccagtatcgagaaccaagtgagaggcaacctggagaatttgttcctgcggtgcccgaaacccacactgcagcagatcagccacatcgcccagcagcttgggctggagaaggatgtggtccgagtgtggttctgtaaccggcgccagaagggcaagcgatcaagcagtggctatgcacaacgagaggattttgaggctgttgggtctcctttctcagggggaccagtgtcctttcctctggccccagggccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccctttccctgagggggaagcctttccccctgtctccgtcaccactctgggctctcccatgcattcaaactgagg
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.