GGRNA Home | Help | Advanced search

2025-05-09 20:07:54, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_034180               1083 bp    RNA     linear   PRI 16-JUL-2013
DEFINITION  Homo sapiens POU class 5 homeobox 1 pseudogene 4 (POU5F1P4),
            non-coding RNA.
ACCESSION   NR_034180
VERSION     NR_034180.1  GI:301336131
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1083)
  AUTHORS   Lin,H., Shabbir,A., Molnar,M. and Lee,T.
  TITLE     Stem cell regulatory function mediated by expression of a novel
            mouse Oct4 pseudogene
  JOURNAL   Biochem. Biophys. Res. Commun. 355 (1), 111-116 (2007)
   PUBMED   17280643
REFERENCE   2  (bases 1 to 1083)
  AUTHORS   Suo,G., Han,J., Wang,X., Zhang,J., Zhao,Y., Zhao,Y. and Dai,J.
  TITLE     Oct4 pseudogenes are transcribed in cancers
  JOURNAL   Biochem. Biophys. Res. Commun. 337 (4), 1047-1051 (2005)
   PUBMED   16229821
REFERENCE   3  (bases 1 to 1083)
  AUTHORS   Wey,E., Lyons,G.E. and Schafer,B.W.
  TITLE     A human POU domain gene, mPOU, is expressed in developing brain and
            specific adult tissues
  JOURNAL   Eur. J. Biochem. 220 (3), 753-762 (1994)
   PUBMED   7908264
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AF268613.1 and AL139410.20.
            
            ##Evidence-Data-START##
            Transcript is intronless :: DQ851566.1, GU480814.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1040              AF268613.1         1-1040
            1041-1041           AL139410.20        128981-128981
            1042-1083           AF268613.1         1041-1082
FEATURES             Location/Qualifiers
     source          1..1083
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q22"
     gene            1..1083
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /note="POU class 5 homeobox 1 pseudogene 4"
                     /pseudo
                     /db_xref="GeneID:645682"
                     /db_xref="HGNC:33310"
     misc_RNA        1..1083
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /product="POU class 5 homeobox 1 pseudogene 4"
                     /pseudo
                     /db_xref="GeneID:645682"
                     /db_xref="HGNC:33310"
     exon            1..1083
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       50
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368132581"
     variation       69
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:28516425"
     variation       78
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112458340"
     variation       96
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200561024"
     variation       103
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113938337"
     variation       161
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7355130"
     variation       164
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370669734"
     variation       310
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113187508"
     variation       350
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116422863"
     variation       352
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181779936"
     variation       356
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113634850"
     variation       400
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184363090"
     variation       437
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55762646"
     variation       474
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12124051"
     variation       495
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374979780"
     variation       525
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147337601"
     variation       576
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138632458"
     variation       602
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181343707"
     variation       603
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186467446"
     variation       723
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112165343"
     variation       808
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190914307"
     variation       843
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180809155"
     variation       860
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55872519"
     variation       884
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150722423"
     variation       909
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185837463"
     variation       1015
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191092172"
     variation       1047
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370210759"
     variation       1066
                     /gene="POU5F1P4"
                     /gene_synonym="POU5FLC1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201857115"
ORIGIN      


atggcgggacacctggcttcggatgcctgccttcttgccccctccaggcggtggaggtgatgggccaggggggccggagccgggctgggttgatcctcggacctggctaagcttccaaggccctcctggagggccaggaatcgggccgggagttgggtcaggctctgaggtgtgggggattcccccatgccccccgctgtatgagttctgtggggggatggcgtactgtgggcctcaggttggagtgcggctagtgccccaaggcggcttggagacctctcagcctgagggcgaagcaggagtcagggtggagagcaactccgatggcacctccctggagccctgcaccgtcccccctggtgccgtgaaactggagaaggagaagctggagcaaaacccgcaggagtcccagaacatcaaagctctgcagaaagaactcgaacaatttgccaagctcctgaagcagaagaggatcaccctgggatatacacaggccgatgtggggctcaccctgggggttctatttgggaaggtgttcagccaaacgaccatctgccgctttgagggtctgcagcttagcttcaagaacatgtgtaagctgcggcccttgctgcagaagtgggtggaggaagctgacaacaatgaaaatcttcaggagacatgcaaagcagaaaccctcttgcaggctcgaaagagaaagcgaaccagtatcgagaaccgagtgagaggcaacctggagaatttgttcctgcagtgcccgaaacccacactgcagcagatcagccacatcgcccagcagcttgggctcgagaaggatgtggtccgagtgtggttctgtaaccggtgccagaaaggcaagcaatcaagcagcgactatgcataacgagaggattttgaggctgctgggtctcctttctcaggggtaccagtatcctttcctctggccccagggccccattttggtaccccaggctatgggagccctcacttcactgcactgtactcctcggtccctttccctgagggggaagcctttcccccgtctccgtcaccaccctgggctctcccatgcattcaaactga
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.