2025-06-19 06:46:14, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_181500 3033 bp mRNA linear PRI 12-MAY-2013 DEFINITION Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 3, mRNA. ACCESSION NM_181500 VERSION NM_181500.2 GI:321400110 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3033) AUTHORS Li,T., Wang,H., Sun,Y., Zhao,L., Gang,Y., Guo,X., Huang,R., Yang,Z., Pan,Y., Wu,K., Xu,L., Liu,Z. and Fan,D. TITLE Transcription factor CUTL1 is a negative regulator of drug resistance in gastric cancer JOURNAL J. Biol. Chem. 288 (6), 4135-4147 (2013) PUBMED 23255599 REMARK GeneRIF: overexpression of active CUTL1 significantly resulted in increased cancer tissue response to chemotherapy and therefore inhibited growth, whereas knockdown of CUTL1 conferred resistance to chemotherapy. REFERENCE 2 (bases 1 to 3033) AUTHORS McNerney,M.E., Brown,C.D., Wang,X., Bartom,E.T., Karmakar,S., Bandlamudi,C., Yu,S., Ko,J., Sandall,B.P., Stricker,T., Anastasi,J., Grossman,R.L., Cunningham,J.M., Le Beau,M.M. and White,K.P. TITLE CUX1 is a haploinsufficient tumor suppressor gene on chromosome 7 frequently inactivated in acute myeloid leukemia JOURNAL Blood 121 (6), 975-983 (2013) PUBMED 23212519 REMARK GeneRIF: Data indicate CUX1 as a conserved, haploinsufficient tumor suppressor frequently deleted in myeloid neoplasms. REFERENCE 3 (bases 1 to 3033) AUTHORS Liu,K.C., Lin,B.S., Zhao,M., Wang,K.Y. and Lan,X.P. TITLE Cutl1: a potential target for cancer therapy JOURNAL Cell. Signal. 25 (1), 349-354 (2013) PUBMED 23085261 REMARK GeneRIF: Cutl1 played transcriptional level mediated by signal transduction, translational level mediated by miR122, posttranslational level such as phosphorylation, de-phosphorylation, acetylation and proteolytic cleavage. Review article REFERENCE 4 (bases 1 to 3033) AUTHORS Sasayama,D., Hiraishi,A., Tatsumi,M., Kamijima,K., Ikeda,M., Umene-Nakano,W., Yoshimura,R., Nakamura,J., Iwata,N. and Kunugi,H. TITLE Possible association of CUX1 gene polymorphisms with antidepressant response in major depressive disorder JOURNAL Pharmacogenomics J. (2012) In press PUBMED 22584459 REMARK Publication Status: Available-Online prior to print REFERENCE 5 (bases 1 to 3033) AUTHORS Zhai,Z., Ha,N., Papagiannouli,F., Hamacher-Brady,A., Brady,N., Sorge,S., Bezdan,D. and Lohmann,I. TITLE Antagonistic regulation of apoptosis and differentiation by the Cut transcription factor represents a tumor-suppressing mechanism in Drosophila JOURNAL PLoS Genet. 8 (3), E1002582 (2012) PUBMED 22438831 REMARK GeneRIF: we find repression of apoptosis regulators by Cux1 in human cancer cells. REFERENCE 6 (bases 1 to 3033) AUTHORS Lievens,P.M., Tufarelli,C., Donady,J.J., Stagg,A. and Neufeld,E.J. TITLE CASP, a novel, highly conserved alternative-splicing product of the CDP/cut/cux gene, lacks cut-repeat and homeo DNA-binding domains, and interacts with full-length CDP in vitro JOURNAL Gene 197 (1-2), 73-81 (1997) PUBMED 9332351 REFERENCE 7 (bases 1 to 3033) AUTHORS Chernousov,M.A., Stahl,R.C. and Carey,D.J. TITLE Schwann cells secrete a novel collagen-like adhesive protein that binds N-syndecan JOURNAL J. Biol. Chem. 271 (23), 13844-13853 (1996) PUBMED 8662884 REFERENCE 8 (bases 1 to 3033) AUTHORS Scherer,S.W., Neufeld,E.J., Lievens,P.M., Orkin,S.H., Kim,J. and Tsui,L.C. TITLE Regional localization of the CCAAT displacement protein gene (CUTL1) to 7q22 by analysis of somatic cell hybrids JOURNAL Genomics 15 (3), 695-696 (1993) PUBMED 8468066 REFERENCE 9 (bases 1 to 3033) AUTHORS Neufeld,E.J., Skalnik,D.G., Lievens,P.M. and Orkin,S.H. TITLE Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut JOURNAL Nat. Genet. 1 (1), 50-55 (1992) PUBMED 1301999 REFERENCE 10 (bases 1 to 3033) AUTHORS Ottolenghi,S., Mantovani,R., Nicolis,S., Ronchi,A. and Giglioni,B. TITLE DNA sequences regulating human globin gene transcription in nondeletional hereditary persistence of fetal hemoglobin JOURNAL Hemoglobin 13 (6), 523-541 (1989) PUBMED 2481658 REMARK Review article COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC410774.1, BC025422.2, BC066592.1, AB075522.1 and BC012323.1. On Feb 4, 2011 this sequence version replaced gi:31652237. Summary: The protein encoded by this gene is a member of the homeodomain family of DNA binding proteins. It may regulate gene expression, morphogenesis, and differentiation and it may also play a role in the cell cycle progession. Several alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Feb 2011]. Transcript Variant: This variant (3) lacks a 6 nt segment at an alternate splice site and has an alternate 3' sequence including the coding region, as compared to variant 4. The resulting isoform (c) lacks two internal amino acids and has a shorter and distinct C-terminus, as compared to isoform d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC025422.2 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025083, ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-119 DC410774.1 1-119 120-1257 BC025422.2 1-1138 1258-1376 BC066592.1 1157-1275 1377-2024 AB075522.1 1035-1682 2025-3033 BC012323.1 1918-2926 FEATURES Location/Qualifiers source 1..3033 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q22.1" gene 1..3033 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="cut-like homeobox 1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="HPRD:00295" /db_xref="MIM:116896" exon 1..190 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" misc_feature 74..76 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="upstream in-frame stop codon" variation 80 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:373949747" variation 97 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:368174106" variation 101 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:371287227" variation 110 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:373609751" CDS 128..2158 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="isoform c is encoded by transcript variant 3; golgi integral membrane protein 6; protein CASP; cut homolog; putative protein product of Nbla10317; homeobox protein cux-1; CCAAT displacement protein" /codon_start=1 /product="protein CASP isoform c" /protein_id="NP_852477.1" /db_xref="GI:31652238" /db_xref="CCDS:CCDS47672.1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="HPRD:00295" /db_xref="MIM:116896" /translation="
MAANVGSMFQYWKRFDLQQLQRELDATATVLANRQDESEQSRKRLIEQSREFKKNTPEDLRKQVAPLLKSFQGEIDALSKRSKEAEAAFLNVYKRLIDVPDPVPALDLGQQLQLKVQRLHDIETENQKLRETLEEYNKEFAEVKNQEVTIKALKEKIREYEQTLKNQAETIALEKEQKLQNDFAEKERKLQETQMSTTSKLEEAEHKVQSLQTALEKTRTELFDLKTKYDEETTAKADEIEMIMTDLERANQRAEVAQREAETLREQLSSANHSLQLASQIQKAPDVAIEVLTRSSLEVELAAKEREIAQLVEDVQRLQASLTKLRENSASQISQLEQQLSAKNSTLKQLEEKLKGQADYEEVKKELNILKSMEFAPSEGAGTQDAAKPLEVLLLEKNRSLQSENAALRISNSDLSGRCAELQVRITEAVATATEQRELIARLEQDLSIIQSIQRPDAEGAAEHRLEKIPEPIKEATALFYGPAAPASGALPEGQVDSLLSIISSQRERFRARNQELEAENRLAQHTLQALQSELDSLRADNIKLFEKIKFLQSYPGRGSGSDDTELRYSSQYEERLDPFSSFSKRERQRKYLSLSPWDKATLSMGRLVLSNKMARTIGFFYTLFLHCLVFLVLYKLAWSESMERDCATFCAKKFADHLHKFHENDNGAAAGDLWQ
" misc_feature 1118..1120 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1382..2062 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="CASP C terminal; Region: CASP_C; pfam08172" /db_xref="CDD:203868" misc_feature 1979..2041 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q13948.2); transmembrane region" variation 152 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:200925347" exon 191..301 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 193 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:140709702" variation 208 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:376836450" variation 223 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150487622" variation 258 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:200309302" variation 265 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:145317607" variation 294 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:149191757" exon 302..349 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 321 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:143267032" variation 322 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:374397164" exon 350..428 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 408 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:367586602" variation 422 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:148322402" exon 429..566 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 498 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:201537465" variation 501 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:77240477" variation 554 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:371126154" exon 567..690 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 574 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:143157780" variation 589 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:201650660" variation 631 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:375357960" variation 632 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:138328289" variation 637 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:11540900" variation 644 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199800281" exon 691..767 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 701 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:142863665" variation 703 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:201993734" variation 748 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:199535463" variation 758 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:150799140" exon 768..834 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 773 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:75508780" variation 783 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:187519642" variation 800 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:139126094" variation 814 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:149507748" exon 835..883 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 861 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:372003626" exon 884..988 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 895 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:377269248" variation 931 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:370842930" variation 933 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:189334175" variation 937 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:180828525" STS 938..1034 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="D12S1228E" /db_xref="UniSTS:151475" variation 942 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:139855321" variation 985 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:143307709" exon 989..1171 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 992 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:200126349" variation 1016 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:372334618" variation 1033 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:139114802" variation 1043 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:376319241" variation 1070 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:142950109" variation 1089 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:369666651" variation 1095 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:367848953" variation 1114 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:151118398" variation 1151 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:201709857" variation 1165 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:374020928" exon 1172..1230 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" exon 1231..1279 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1257 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141118279" variation 1258 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:11540899" exon 1280..1376 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1285 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:147937477" variation 1327 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:369005585" variation 1347 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:374021528" variation 1348 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:367577378" variation 1352 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:371301313" exon 1377..1504 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1386 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:62001055" variation 1387 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:813000" variation 1401 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:372464298" variation 1421 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:114381819" variation 1425 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:139906438" variation 1429 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:149786604" variation 1442 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:371828253" variation 1447 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:200271633" variation 1451 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:145765083" variation 1452 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:375278390" variation 1501 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:370845468" exon 1505..1571 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1511 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:803064" variation 1512 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:368235304" variation 1520 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:144199298" variation 1521 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:146554363" variation 1551 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:199558313" variation 1557 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:140386892" exon 1572..1684 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1591 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199776060" variation 1592 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150976222" variation 1597 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:140831161" variation 1606 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:371715592" variation 1622 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:375776301" variation 1659 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150151598" variation 1674 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:2230102" variation 1684 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199822336" exon 1685..1801 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1694 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:138450169" variation 1699 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:369806479" variation 1715 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:142767232" variation 1747 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:146927122" variation 1754 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:2230103" variation 1757 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:118010189" variation 1780 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:373393100" variation 1799 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:144393643" variation 1800 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:148760130" exon 1802..1885 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1808 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:187131238" variation 1821 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:370290068" variation 1822 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:375513246" variation 1829 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141515782" variation 1830 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:202149844" variation 1836 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:150890071" variation 1846 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:111537304" variation 1847 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:139293638" variation 1852 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:144329021" variation 1853 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:146049827" variation 1883 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:371285615" variation 1884 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:140034854" exon 1886..1942 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1896 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:1293839" variation 1930 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:372229678" exon 1943..2023 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1947 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:144124584" variation 1973 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:372479780" STS 1974..2058 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="MARC_4357-4358:991938494:5" /db_xref="UniSTS:231083" variation 1974 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:145083539" variation 1982 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:201615556" exon 2024..2088 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 2033 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:367747037" variation 2038 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:149124693" variation 2047 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:200899513" variation 2048 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:142155041" variation 2050 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:151204833" exon 2089..3026 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 2092 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141196267" variation 2093 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:376508181" variation 2116 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:200345816" variation 2117 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:377645698" variation 2129 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:369144524" variation 2143 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:112505360" variation 2154..2155 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="" /replace="g" /db_xref="dbSNP:146386435" variation 2176 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199575958" variation 2177 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:373876353" variation 2183 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:909128" variation 2187 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:201628239" variation 2188 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:377408845" variation 2194 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:374386627" variation 2214 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:1296069" variation 2271 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:151048012" variation 2297 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:141097964" variation 2331 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150278456" variation 2369 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:2734615" variation 2377 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:185803208" variation 2390 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:75580662" variation 2408 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:191591974" variation 2436 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:41275221" variation 2505 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:182997186" variation 2564 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:113634317" variation 2565 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:188776036" variation 2593 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:147926104" variation 2668 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:77369840" STS 2762..3024 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="WI-21075" /db_xref="UniSTS:50237" variation 2763 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:192033664" STS 2868..3025 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="RH44454" /db_xref="UniSTS:53362" variation 2875 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:8950" variation 2884 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:1056363" variation 2885 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141716299" variation 2901 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:182766749" variation 2907 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:75104200" variation 2936 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:1056386" variation 2962 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:9691899" polyA_signal 3006..3011 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" variation 3024 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:73187873" polyA_site 3026 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" ORIGIN
ctcggtggcggcggcggcggccggctccaggccgggttttggcgccgcccgcctgctgcctcctggcggctcctgaactccagccccctctctatcagccgctcactccgtctcaatatgtctcaagatggcggccaatgtgggatcgatgtttcaatattggaagcgctttgatttacagcagctgcagagagaactcgatgccaccgcaacggtattggcgaaccggcaggatgaaagtgagcagtccagaaagcggcttatcgaacagagccgggagttcaagaagaacactccagaggatttgcgcaagcaggtagcgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagcaaggaagctgaagcagctttcttgaatgtctacaaaagattgattgacgtcccagatcccgtaccagctttggatctcggacagcaactccagctcaaagtgcagcgcctgcacgatattgaaacagagaaccagaaacttagggaaactctggaagaatacaacaaggaatttgctgaagtgaaaaatcaagaggttacgataaaagcacttaaagagaaaatccgagaatatgaacagacactgaagaaccaagccgaaaccatagctcttgagaaggaacagaagttacagaatgactttgcagaaaaggagagaaagctgcaggagacacagatgtccaccacctcaaagctggaggaagctgagcataaggttcagagcctacaaacagccctggaaaaaactcgaacagaattatttgacctgaaaaccaaatacgatgaagaaactactgcaaaggccgacgagattgaaatgatcatgacggaccttgaaagggcaaaccagagggcagaggtggctcagagagaggcggagaccttaagggaacagctctcatcggccaatcactccctccagctggcctcacagatccagaaggcaccagacgtggccatagaggtgctgacccgctccagcctagaagttgagttggccgccaaggagcgggagatcgcacagctggtggaggacgtgcagagactccaggccagcctcaccaagctgcgggagaattcggccagccagatctcacagcttgagcagcagctgagcgccaaaaacagcacactcaaacaactggaagaaaaactcaaaggccaggctgactatgaagaggtgaagaaagagctgaacattctgaagtccatggagtttgcaccgtccgagggcgctgggacacaggatgcggccaagcccctggaggtgctgttgctggagaagaaccgctcgctgcagtccgagaacgccgcgctgcgcatctccaacagcgacctgagcggacgctgtgcagagctgcaagtccgtatcactgaggctgtggccacagccactgagcagagagagctgatcgcccgcctggagcaggacctgagcatcattcagtccatccagcggcccgatgccgagggtgccgctgagcaccgcctggagaagatcccagagcccatcaaagaggccactgccctattctacggacctgcagcaccagccagcggtgccctcccagagggccaggtggattcactgctttccatcatctccagccagagggagcgcttccgtgcccggaaccaggagcttgaggccgagaaccgcctggcccagcacaccctccaggccctgcagagtgagctggacagcctgcgcgccgacaacatcaagctctttgagaagatcaagttcctgcagagctaccctggccggggcagcggcagtgatgacacggagctgcggtactcgtcccagtacgaggagcgcctggaccccttctcctccttcagcaagcgggagcggcagaggaagtacctgagcttgagtccctgggacaaggccaccctcagcatggggcgtctggttctctccaacaagatggcgcgcaccatcggcttcttctacacactgttcctgcactgcctggtcttcctggtgctctacaagctggcatggagcgagagcatggagagggactgtgccaccttctgcgccaagaagttcgctgaccacctgcacaagttccacgagaatgacaacggggctgcggctggtgacttgtggcagtgataccccggggcctcccccgtgacagtgacggctgcgcctccaccccgactgctcagtgcatctaatcacttagactcccctgaagaatcccccatggaaactgcccttatccgctgtccagcagctgccagaggccccaggtcacctcgggtccccttgaaagaatgtctcggtcacatcaggcccgctaggtccagagagcgagcccccaatgcccggccaggctaagccgcagagaccctctcagcccccacctcaggttagggctctgcccgcagcctgacctctagccctggtggcagaggtccctcagctgcgaggctaattgggtgaccaccgattccagctgcggttaatccagcttgggcctgtctgcactgcgatcctcttgggctctcctaggatccccccatgccccgtaagaggtggaagacgcttccttccaggacagcaggctttgagtccagcacccccagcctgcctttgccaccagccccaccctgcagagtatatgaggcttgacagagtctgccccctcccccactgcaccccaagagagagagccccagccagcggaacagtttctattaccccctccctgcccccagacccatgtgatttctgctttcttctttagcaagatattctggtttctagataaggaagagtctctaatgagcccccgagccccagtctcttcagactcatggattggtctgaggggtctgaacgtctcctagccaatcagaactggctgtggaccaccctagcacggccacctctcagggccactggcaggccttcctgagttagatttgtagttgcatatttagctttgcacatttgaaataaaccacggttgcagccaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1523 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA GeneID:1523 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:1523 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IEA GeneID:1523 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:1523 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:1523 -> Biological process: GO:0000301 [retrograde transport, vesicle recycling within Golgi] evidence: IEA GeneID:1523 -> Biological process: GO:0001822 [kidney development] evidence: IEA GeneID:1523 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:1523 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS GeneID:1523 -> Biological process: GO:0006891 [intra-Golgi vesicle-mediated transport] evidence: IEA GeneID:1523 -> Biological process: GO:0007275 [multicellular organismal development] evidence: TAS GeneID:1523 -> Biological process: GO:0030324 [lung development] evidence: IEA GeneID:1523 -> Biological process: GO:0042491 [auditory receptor cell differentiation] evidence: IEA GeneID:1523 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA GeneID:1523 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1523 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:1523 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:1523 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1523 -> Cellular component: GO:0030173 [integral to Golgi membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.