Home |
Help |
Advanced search
2025-05-09 20:22:17, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_153832 8222 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens G protein-coupled receptor 161 (GPR161), transcript
variant 3, mRNA.
ACCESSION NM_153832
VERSION NM_153832.2 GI:390190200
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 8222)
AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
TITLE Follow-up of a major linkage peak on chromosome 1 reveals
suggestive QTLs associated with essential hypertension: GenNet
study
JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
PUBMED 19536175
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 2 (bases 1 to 8222)
AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
genetic association with bone mineral density variation
JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009)
PUBMED 19064610
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 3 (bases 1 to 8222)
AUTHORS Matteson,P.G., Desai,J., Korstanje,R., Lazar,G., Borsuk,T.E.,
Rollins,J., Kadambi,S., Joseph,J., Rahman,T., Wink,J., Benayed,R.,
Paigen,B. and Millonig,J.H.
TITLE The orphan G protein-coupled receptor, Gpr161, encodes the
vacuolated lens locus and controls neurulation and lens development
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 105 (6), 2088-2093 (2008)
PUBMED 18250320
REFERENCE 4 (bases 1 to 8222)
AUTHORS Small,K.M., Seman,C.A., Castator,A., Brown,K.M. and Liggett,S.B.
TITLE False positive non-synonymous polymorphisms of G-protein coupled
receptor genes
JOURNAL FEBS Lett. 516 (1-3), 253-256 (2002)
PUBMED 11959142
REMARK GeneRIF: False positive non-synonymous polymorphisms of G-protein
coupled receptor genes.
REFERENCE 5 (bases 1 to 8222)
AUTHORS Schoneberg,T., Schulz,A. and Gudermann,T.
TITLE The structural basis of G-protein-coupled receptor function and
dysfunction in human diseases
JOURNAL Rev. Physiol. Biochem. Pharmacol. 144, 143-227 (2002)
PUBMED 11987825
REMARK Review article
REFERENCE 6 (bases 1 to 8222)
AUTHORS Raming,K., Konzelmann,S. and Breer,H.
TITLE Identification of a novel G-protein coupled receptor expressed in
distinct brain regions and a defined olfactory zone
JOURNAL Recept. Channels 6 (2), 141-151 (1998)
PUBMED 9932290
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AL033532.36, BC028163.1 and AA662800.1.
On Jun 7, 2012 this sequence version replaced gi:24476015.
Summary: Upon ligand binding, G protein-coupled receptors, such as
GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320),
allowing the receptors to transduce extracellular signals across
the plasma membrane into the cell. Phosphorylation of the receptor
attenuates signaling (Matteson et al., 2008 [PubMed
18250320]).[supplied by OMIM, Aug 2008].
Transcript Variant: This variant (3) lacks an alternate exon in the
5' UTR, lacks a portion of the 5' coding region, and initiates
translation at a downstream start codon, compared to variant 1.
The resulting protein (isoform 2) is shorter compared to isoform 1.
Variants 2 and 3 encode the same protein (isoform 2).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: BC028163.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025084, ERS025086 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-321 AL033532.36 65224-65544 c
322-2997 BC028163.1 1-2676
2998-8045 AL033532.36 8548-13595 c
8046-8222 AA662800.1 1-177 c
FEATURES Location/Qualifiers
source 1..8222
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q24.2"
gene 1..8222
/gene="GPR161"
/gene_synonym="RE2"
/note="G protein-coupled receptor 161"
/db_xref="GeneID:23432"
/db_xref="HGNC:23694"
/db_xref="HPRD:17070"
/db_xref="MIM:612250"
exon 1..451
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
exon 452..497
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
exon 498..591
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
misc_feature 573..575
/gene="GPR161"
/gene_synonym="RE2"
/note="upstream in-frame stop codon"
exon 592..1009
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
CDS 636..2225
/gene="GPR161"
/gene_synonym="RE2"
/note="isoform 2 is encoded by transcript variant 3;
G-protein coupled receptor 161; G-protein coupled receptor
RE2"
/codon_start=1
/product="G-protein coupled receptor 161 isoform 2"
/protein_id="NP_722561.1"
/db_xref="GI:24476016"
/db_xref="CCDS:CCDS1268.1"
/db_xref="GeneID:23432"
/db_xref="HGNC:23694"
/db_xref="HPRD:17070"
/db_xref="MIM:612250"
/translation="
MSLNSSLSCRKELSNLTEEEGGEGGVIITQFIAIIVITIFVCLGNLVIVVTLYKKSYLLTLSNKFVFSLTLSNFLLSVLVLPFVVTSSIRREWIFGVVWCNFSALLYLLISSASMLTLGVIAIDRYYAVLYPMVYPMKITGNRAVMALVYIWLHSLIGCLPPLFGWSSVEFDEFKWMCVAAWHREPGYTAFWQIWCALFPFLVMLVCYGFIFRVARVKARKVHCGTVVIVEEDAQRTGRKNSSTSTSSSGSRRNAFQGVVYSANQCKALITILVVLGAFMVTWGPYMVVIASEALWGKSSVSPSLETWATWLSFASAVCHPLIYGLWNKTVRKELLGMCFGDRYYREPFVQRQRTSRLFSISNRITDLGLSPHLTALMAGGQPLGHSSSTGDTGFSCSQDSGTDMMLLEDYTSDDNPPSHCTCPPKRRSSVTFEDEVEQIKEAAKNSILHVKAEVHKSLDSYAASLAKAIEAEAKINLFGEEALPGVLVTARTVPGGGFGGRRGSRTLVSQRLQLQSIEEGDVLAAEQR
"
misc_feature 726..788
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
misc_feature 828..890
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
misc_feature 909..1607
/gene="GPR161"
/gene_synonym="RE2"
/note="7 transmembrane receptor (rhodopsin family);
Region: 7tm_1; pfam00001"
/db_xref="CDD:200918"
misc_feature 939..1004
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
misc_feature 1065..1127
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
misc_feature 1206..1268
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
misc_feature 1443..1505
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
misc_feature 1554..1616
/gene="GPR161"
/gene_synonym="RE2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N6U8.1);
transmembrane region"
exon 1010..1734
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
exon 1735..1839
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
exon 1840..1959
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
exon 1960..8214
/gene="GPR161"
/gene_synonym="RE2"
/inference="alignment:Splign:1.39.8"
STS 2384..3135
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="GPR161_2270"
/db_xref="UniSTS:280714"
variation 2721
/gene="GPR161"
/gene_synonym="RE2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1051426"
variation 2827
/gene="GPR161"
/gene_synonym="RE2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1051428"
STS 2885..3024
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="RH98556"
/db_xref="UniSTS:92344"
STS 4125..4257
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="pchcms1"
/db_xref="UniSTS:539559"
variation 6320
/gene="GPR161"
/gene_synonym="RE2"
/replace="c"
/replace="g"
/db_xref="dbSNP:3202895"
STS 6615..6719
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="D11S3114"
/db_xref="UniSTS:152207"
STS 6657..6827
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="D1S1425"
/db_xref="UniSTS:149621"
STS 8021..8191
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="A004N15"
/db_xref="UniSTS:18315"
STS 8088..8222
/gene="GPR161"
/gene_synonym="RE2"
/standard_name="WI-13488"
/db_xref="UniSTS:83528"
ORIGIN
cccgggcggagagggcggtccggatggagccaggctaaactcattgtgcgaggctgagggctcagggcgcgggccgggaagggtccccgcccccacggcgctccctttctccccgcgcccctctcggaggtcagggctgtcctccgcccgcactgcgccttgctttggagagctggagctctttgtgggaagatgttgggggcgcgcccctcccctgcggcctggggcttctgagaggcccaccccattctgctgggtgcagcccgccccgtttctccggcgccgcccgaagcccctaaacagtccgctggatgggagggcgtaggtgcgtgcccgggactctgccgatgcgggccgcgccccctggggccaagagactccacgtcccgctcagggcaaagggtgtggggagaagcggtcacgcccctcggctggaatccgtgaggaccaggtctttttcagtgtgctcaatatggtcaccaagcctggaaacatagagtctcaccctgttgcttaggcagatggcgcgatctcggctcctgggttcaagcaattctcctgcctcagcctcctgaatagccgggattacagtcgtccagcatgctctgcccaccccacgccgaggtgcactgaccatgagcctcaactcctccctcagctgcaggaaggagctgagtaatctcactgaggaggagggtggcgaagggggcgtcatcatcacccagttcatcgccatcattgtcatcaccatttttgtctgcctgggaaacctggtcatcgtggtcaccttgtacaagaagtcctacctcctcaccctcagcaacaagttcgtcttcagcctgactctgtccaacttcctgctgtccgtgttggtgctgccttttgtggtgacgagctccatccgcagggaatggatctttggtgtagtgtggtgcaacttctctgccctcctctacctgctgatcagctctgccagcatgctaaccctcggggtcattgccatcgaccgctactatgctgtcctgtaccccatggtgtaccccatgaagatcacagggaaccgggctgtgatggcacttgtctacatctggcttcactcgctcatcggctgcctgccacccctgtttggttggtcatccgtggagtttgacgagttcaaatggatgtgtgtggctgcttggcaccgggagcctggctacacggccttctggcagatctggtgtgccctcttcccctttctggtcatgctggtgtgctatggcttcatcttccgcgtggccagggtcaaggcacgcaaggtgcactgtggcacagtcgtcatcgtggaggaggatgctcagaggaccgggaggaagaactccagcacctccacctcctcttcaggcagcaggaggaatgcctttcagggtgtggtctactcggccaaccagtgcaaagccctcatcaccatcctggtggtcctcggtgccttcatggtcacctggggcccctacatggttgtcatcgcctctgaggccctctgggggaaaagctccgtctccccgagcctggagacttgggccacatggctgtcctttgccagcgctgtctgccaccccctgatctatggactctggaacaagacagttcgcaaagaactactgggcatgtgctttggggaccggtattatcgggaaccatttgtgcaacgacagaggacttccaggctcttcagcatttccaacaggatcacagacctgggcctgtccccacacctcactgcgctcatggcaggtggacagcccctggggcacagcagcagcacgggggacactggcttcagctgctcccaggactcagggacagatatgatgctgcttgaggactacacgtctgatgacaaccctccctctcactgcacttgcccacccaagagaaggagctcggtgacatttgaggatgaagtggaacaaatcaaagaagctgccaagaactcgattcttcatgtgaaagctgaagtacacaagtccttggacagttacgcagcaagcttggccaaagccattgaggccgaagccaaaatcaacttatttggggaggaggctttgccaggggtcttggttacagcacggactgtcccggggggcggcttcgggggccgccgaggcagcagaactcttgtgagccagaggctgcagttgcagagcatcgaagaaggagatgttttagctgccgagcagagatgagggcctcagggtgccgtggggctgcagcctgagaggctggcccggggaggagttcccatcaccgcctgtgccgcggccttgggagcatgtcactgtgtacagctggccacacacagggaaggagcagcatctggtatgcagccaccaggacaaggactgaaaataatgtctacagtccacagcttcagcatttccagagaccacatgtgagcttcttttaggtcccagtgatgggaccagaagcatctaaagcaaaaaaaaaaccaaaaaaaaatctagagatgtggctgtggctttttgggaggtggggcatgggaggaccagagacgaagggcttggaaggagacccccacatgcatcatttcctcctcttcacagtgtgctgggagtccagccgtgcactgtgccagatgcctcaggaggagaaccctccccagtgtactgtgaaggatgacacagcacttcttcctaatgacacgcgaccgtcctggtgcctctacatggttgatgcgggcagtgtgggaccctcagttctaggactggtccgcagagaaagcacccaggagcagagcgcttcggagcggtcctcagtggcgccacctgctggtgctaatagggacagccacaggcctcttgcagactggcccaccctgcctacttccctactgacaagttctttggtatttcaaaagggagaaaccactataaaagacaagaggaagggcaggtactaggtgtttcatttccagaattaaaaaaaaaatccatttaagacgtaccactgttttaccggactgaatgggactgtagtgccaagcacagccaggaaatagagaaactgttattatggaagggaatttgttcacatgggaaagcctcattaaatagattctatgtgtgatgtttgagtgaccaatgaaaatagctggcctcagttctgcatggcacactcccaagagcaacagttactattatcacaagcctggtataaataagatagaagcagccctggacccacagccagcaacctgggttattggcccagctctgtctttgtgtgcacatgtcatttggacatcttgtcacctttctaggtcctctgtaaagtgggaaaacagagtggagttggattgaatggtctccaagatcatttccagctctgacctttggtgttctcaggatttgtaaagcagagataggtaaaacacaaaagcagacccacggaccgacctttgtataactttggagtgtggttgctcatgcacatgtgaagtgcaggcagatcaaggttctgtggctttgtctgccctgtccattagagcacaatctggatagaatgccagccaccaagatgcatgaggggcagggtcaccatctcagaaggggaagcacaggaatgtgattgggatggttaaacctctcttctcctccctttgtgctggaacagcagttgaagtttggtcctggagtaattgctgtgatgacttgggaagccactgatctcctcttgcgtctgcccttggcctgcatcatgactaaataagttcaggacttctctgctttggttggcagaaggtagattccaaggagatcttgctggttgctgagaggcagctgttctagaaagtgaattacccttgtggttttttctttggggcccagctagctcctggtgaggttgtgtttttgtgttgtgtggcagaaaccaatggttagctggtcccctggtctgcagtttgtaaaagacctttcatgaggcctggagtcttgctacctgtggtgattgaactcaactattctgggtcacctggatgccaggcgctggcctagcttctggatgggagtgggaaggagcagagggcaggttcacctgtgcaggtcagacactctgcttccatcactggatggcattcctacgtctgcgtgtggttcacgttttctatatatattccctgtatatatttttttctagcacttgtctactttctgaagggaccatattcctgatcaactagtgtgcacagaggtggaacagggcagagagacctttatctctaggatgggttgctggttaggtgtaggcattcttgagtgcagcagcttggctttgaaacgcaagggttggagaatgttcccctgactgtactagactgggctctagggaaagaatcctgagacagccccccactcccccactgaccccacactagctgggctattatagaatttaatctaaatctagaaatactgcatttcacaaaatgattcactgtgtttccctttttttactgaggtccaattcatttagtcgtctaccagacactgcacatccagtgtatgcgaagcaccaggctaggctctgtaggcaataccactaaagtgtgcactctgatttagggagcaggacctgtggataccgattctaataactagcaaagtcaagtcgtggttatagaaagaagtgtggcttcagagggaggtgggtatttccaaatatggagttagggatggctccatgaggtaagtgacagtttgagctaagtcttgaaggatgcttggcagctagaaccatattttccatattcaggaattcaaatttgcctttattcagctagagagaaagagagaagggggtgtgggggagaaggaaaagagaattttcacacattttgaagttcctgagagcatttctgaggatatctgccgttagtgcagaaggtcgaaaccccaagtgcccccactaaacccaggctctttagctgtaaactgccatgcagtggcaggcctgcagccttcctgatgggaccacatggacagtggcacatgggacatttggctactcgttagcttaaacaactcagtcctgtgtcttctggttttgacaagaccacatttaggactgctgcccacctctgcctctttcattgagatttccgccttattgggtccctgtgctatgccacagataccaggtttggggttgttttgacccagaaggcattgggagtcccacattacagagcacacacacagctcaacacagccatttccctggccagaggcaccaagactgaagttcaggcccttagacactaggtggcagcggtgtggctgtgcagagccaaggatgaacctgagagcttgtttgcctctggctgggcactcttgttttgaattcctttgcccttatcgtgtagtccacggccttggtgaccaaggaccacctggctagcctgcttacatgcatgaccccatccaggttcacaggtattgccactgagtgatcttaggtagatcactgctcctggagaagcagagttgaggagtgtaagacaagggccatctagtgccaatgttccttgattcttatttgaggagctactatgtggtctttctgtaaacaagtgaacaaccaatgagactaaatatttgcaatagataggctaaggaatttgggttgagacaggagacggaggaaaaatgctttgatacaatgacagatggttagtctcttcagatttccctgaatattttccatcccgacaatatgcctcttagatacttgcagattagacatgtctctggatggaccacaagatacattcacaacatgtgttcagccttgagccctggctgtgtcctgtctggaaggaactgaggatgatgtggctataaagaggaggcagtgagctggcatgtgactgccttctgtgggcctgacctgtttgacatttgagggcctatgatgtgctaggtgctgtgttaggtacttccaaatgctttatctcattttaccccagtgcaagtgtgatatagtgaggatggtgaagacgtgggtatggttaagtcatgagttcagatcccgtgcttccaattacatgggtgttttcaaacaagtcactacttatgagtttcctcatctgtgaagggaagtttagtcatctgtttcaatgtggagacacacaggattgagggagtcctccgtcacagggtgactgtctggattctatgaggaaatacttggaaagcatgcagcacaatgcctggggtgcagctgaagctgagccactggtgtttcttcacagtatctctgtggggagggtgtattattcctttttatagggatctctataatgaagtgagaatcttgaaaatataagtgttatcctagatgggaggtgttaaaggtttttgccttgggaattttgtcatatttgttgcacagcaaggaaggactttcagaaaagcagggatgtggtgaggaagagcaggcaatagagagcagggaggaaaggctaagtagcatctggaacttgagaagtctaagggagccaaaatgagattttctattaaaaatgtctatcctcagccgggcgtggtagctcacgcctgtaatcccagcactttggggggtcgagatgggcagatcacctgaggtcaggagttcgagaccagcctgaccaatatggagaaaccccgtctctactaaaaatacaaaattagttgcgcgtggtggtgggcgcctgtaatcccagctactcaggagcctgaggcaggagaatcacttaaacccaggaggcggaggttgcagtgagccgagatcgcgccattgcactccagcctgggcaacaagagcgaaaccccgcctaaaaaaagaaaaaaaagaaaaagtctatcctctatgctactggcctgtttgtacaaagataaaatcattctaatttgtccggaatgactatcaaagatgatcaaatccccagggcctggtgtaacgttccaaatcatagcacaaatacagcttgaccttccttacagtccagaaaggacattctccctgagaaatgcccttggttgctgaggacagctctgtcctgtagtgacagagtgactgcctggctgtggctcttgggttcacagaatccctaatcctccaagcccctaagaggcagggcagggatgctacccacaatatatgcagaaccccagatggagcctgtgggagagagaggaaattaccgtcttcactgtaggcaaaggagaatggctgtgattagccatatatgcctataagaaggagcagagccatactgtccttgtgggttgggagaggggacacagaatccagggcaattgtctgaggtctcaaagtaagttaagccagagtcaaagccaaactccaagtcttggccaaggggatgagaaaagcaaggagctagtcttataggtcaaggaagatgaggtatagttaagagtcatcagtatcacagaacaggccagcagggctttattaggtatgtagaactattataaaccaaggatcttgggagatattaatatctgctggccagacctaaaaaaaactgaaggcccaaggaaagtgactggactcactggaaagtatctaacaaatactttggattccaaagtatttccaataccttgaagattcctttgaaaacatcaaagcacaaactcaaatctgcacaagattacaaaagcacaattttggtgttatttttagaatgcaatacacaaagctatgttcatttctctcagcaagcattttcctgggtagtagtaatagcttaggaatcaaatgccacttttgtttttccttttttcactagtttgaaataccacaaatcacaggtgagtcagtcctcccagaggaaaagacagtcctagggagaatcacaggcctggcagacaagaccacactgagagcagtagaaggaacctgcatgcttaagggacagaggactgtgttgtgttctcataatagaccgctggatgaagaagtggttaaaaaccaaccctcgaaaaacaaaaatccctggctaatcctgaaatatatttaacttgaagtctttggatgatttttttaaggttaaaaaaaagtttaggattattataaatcaatatttataaataagcaacaatgtatttggaatttttgtttacctgattaaatatgtttttggtatgtgtaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:23432 -> Molecular function: GO:0004930 [G-protein coupled receptor activity] evidence: ISS
GeneID:23432 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: ISS
GeneID:23432 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
GeneID:23432 -> Biological process: GO:0030819 [positive regulation of cAMP biosynthetic process] evidence: ISS
GeneID:23432 -> Biological process: GO:1901621 [negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning] evidence: ISS
GeneID:23432 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
GeneID:23432 -> Cellular component: GO:0055037 [recycling endosome] evidence: ISS
GeneID:23432 -> Cellular component: GO:0060170 [cilium membrane] evidence: IEA
GeneID:23432 -> Cellular component: GO:0072372 [primary cilium] evidence: ISS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.