LOCUS       NM_133267               1212 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens GS homeobox 2 (GSX2), mRNA.
ACCESSION   NM_133267
VERSION     NM_133267.2  GI:193211415
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1212)
  AUTHORS   Mendez-Gomez,H.R. and Vicario-Abejon,C.
  TITLE     The homeobox gene Gsx2 regulates the self-renewal and
            differentiation of neural stem cells and the cell fate of postnatal
            progenitors
  JOURNAL   PLoS ONE 7 (1), E29799 (2012)
   PUBMED   22242181
  REMARK    GeneRIF: Gsx2 negatively regulates neurogenesis from postnatal
            progenitor cells.
REFERENCE   2  (bases 1 to 1212)
  AUTHORS   Shibata,M., Nakao,H., Kiyonari,H., Abe,T. and Aizawa,S.
  TITLE     MicroRNA-9 regulates neurogenesis in mouse telencephalon by
            targeting multiple transcription factors
  JOURNAL   J. Neurosci. 31 (9), 3407-3422 (2011)
   PUBMED   21368052
  REMARK    GeneRIF: Transgenic mice lacking microRNAs miR-9-2 and miR-9-3
            exhibit multiple defects of telencephalic structures which may be
            brought about by dysregulation of Foxg1, Nr2e1, Gsh2, and Meis2
            expression.
REFERENCE   3  (bases 1 to 1212)
  AUTHORS   Waclaw,R.R., Wang,B., Pei,Z., Ehrman,L.A. and Campbell,K.
  TITLE     Distinct temporal requirements for the homeobox gene Gsx2 in
            specifying striatal and olfactory bulb neuronal fates
  JOURNAL   Neuron 63 (4), 451-465 (2009)
   PUBMED   19709628
  REMARK    GeneRIF: Gsx2 specifies striatal projection neuron and olfactory
            bulb interneuron identity at distinct time points during
            neurogenesis in transgenic mice.
REFERENCE   4  (bases 1 to 1212)
  AUTHORS   Wu,C., Ma,M.H., Brown,K.R., Geisler,M., Li,L., Tzeng,E., Jia,C.Y.,
            Jurisica,I. and Li,S.S.
  TITLE     Systematic identification of SH3 domain-mediated human
            protein-protein interactions by peptide array target screening
  JOURNAL   Proteomics 7 (11), 1775-1785 (2007)
   PUBMED   17474147
REFERENCE   5  (bases 1 to 1212)
  AUTHORS   Dauwerse,J.G., De Die-Smulders,C.E., Bakker,E., Breuning,M.H. and
            Peters,D.J.
  TITLE     Heterozygous truncating mutation in the human homeobox gene GSH2
            has no discernable phenotypic effect
  JOURNAL   J. Med. Genet. 39 (9), 686-688 (2002)
   PUBMED   12205114
REFERENCE   6  (bases 1 to 1212)
  AUTHORS   Cools,J., Mentens,N., Odero,M.D., Peeters,P., Wlodarska,I.,
            Delforge,M., Hagemeijer,A. and Marynen,P.
  TITLE     Evidence for position effects as a variant ETV6-mediated
            leukemogenic mechanism in myeloid leukemias with a
            t(4;12)(q11-q12;p13) or t(5;12)(q31;p13)
  JOURNAL   Blood 99 (5), 1776-1784 (2002)
   PUBMED   11861295
  REMARK    GeneRIF: ectopically expressed in myeloid leukemic cells with
            t(4;12)(q11-q12;p13), suggesting that expression of GSH2 was
            deregulated by the translocation, indicating a variant leukemogenic
            mechanism for translocations involving the 5' end of ETV6
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            EU596451.1, BC075090.2 and AI360912.1.
            On Jun 28, 2008 this sequence version replaced gi:18959211.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB028838.1, BC075090.2 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-242               EU596451.1         1-242
            243-1205            BC075090.2         1-963
            1206-1212           AI360912.1         471-477
FEATURES             Location/Qualifiers
     source          1..1212
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q12"
     gene            1..1212
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /note="GS homeobox 2"
                     /db_xref="GeneID:170825"
                     /db_xref="HGNC:24959"
                     /db_xref="HPRD:13612"
     exon            1..838
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /inference="alignment:Splign:1.39.8"
     variation       47
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368553397"
     STS             195..1212
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /db_xref="UniSTS:480803"
     misc_feature    208..210
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /note="upstream in-frame stop codon"
     variation       221
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370144954"
     variation       225
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375280653"
     variation       228
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367974428"
     STS             243..1205
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /db_xref="UniSTS:482364"
     CDS             265..1179
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /note="homeobox protein GSH-2"
                     /codon_start=1
                     /product="GS homeobox 2"
                     /protein_id="NP_573574.1"
                     /db_xref="GI:18959212"
                     /db_xref="CCDS:CCDS3494.1"
                     /db_xref="GeneID:170825"
                     /db_xref="HGNC:24959"
                     /db_xref="HPRD:13612"
                     /translation="

MSRSFYVDSLIIKDTSRPAPSLPEPHPGPDFFIPLGMPPPLVMSVSGPGCPSRKSGAFCVCPLCVTSHLHSSRGSVGAGSGGAGAGVTGAGGSGVAGAAGALPLLKSQFSSAPGDAQFCPRVNHAHHHHHPPQHHHHHHQPQQPGSAAAAAAAAAAAAAAAALGHPQHHAPVCTATTYNVADPRRFHCLTMGGSDASQVPNGKRMRTAFTSTQLLELEREFSSNMYLSRLRRIEIATYLNLSEKQVKIWFQNRRVKHKKEGKGTQRNSHAGCKCVGSQVHYARSEDEDSLSPASANDDKEISPL

"
     misc_feature    871..1047
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(871..885,889..891,940..942,958..960,997..999,
                     1003..1008,1015..1020,1024..1032,1036..1041)
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(877..879,886..888,1006..1008,1015..1020,1027..1029)
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       272
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377377329"
     variation       273
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140713069"
     variation       285
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144560606"
     variation       298
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145597698"
     variation       310
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201536623"
     variation       324
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148460532"
     variation       397
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371417798"
     variation       403
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200996880"
     variation       408
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370613209"
     variation       420
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3194383"
     variation       428
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150979273"
     variation       432
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140790882"
     variation       446
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371317920"
     variation       482
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375038462"
     variation       583
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13144341"
     variation       672
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1132998"
     variation       726
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371991245"
     exon            839..1212
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /inference="alignment:Splign:1.39.8"
     variation       885
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368607199"
     variation       888
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61737615"
     variation       947
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374243147"
     variation       969
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201527645"
     variation       1008
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181479968"
     variation       1043
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200779011"
     variation       1062
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144670003"
     variation       1107
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146677175"
     variation       1108
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140212063"
     variation       1147
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145163904"
     variation       1152
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187314393"
     variation       1206
                     /gene="GSX2"
                     /gene_synonym="GSH2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141885097"
ORIGIN      

gaggagcctgagccgagcggtactccgcagcatcacgtgccagggtggggggctataaaatacccgagccggggcgccgggcgggggacgtgaggaccagccctctccggggacccctttgttcccagcccagacgccaacacctctgcgtccccaagggcttgactgcccgtgtctgcgcggctcccagggcagagcttagaacactagaggagaggggtcgccgcgaactgccggggcttccagccacccacccctctcgacatgtcgcgctccttctatgtcgactcgctcatcatcaaggacacctcacggcctgcgccctcgctgcctgaaccgcaccccgggccggatttcttcatcccgcttggcatgccgcccccattggtgatgtccgtgtccggccccggctgcccgtcccgcaagagcggcgcgttctgcgtgtgccctctctgcgtcacttcgcacctgcactcctctcgggggtctgtgggcgccggcagcgggggcgcaggggccggggttaccggggccggaggcagtggggtggcaggggccgcaggggcactgcctctgcttaagagccagttctcttcggctcctggggacgcgcagttttgcccgcgggtgaaccatgcgcatcatcaccaccacccgccgcagcaccaccatcaccatcatcagccccagcagcctggctcggccgcggcggcggcagcagcagcagcggcggcggcggccgcggcggccttggggcacccgcagcaccacgcacctgtctgcaccgccaccacctacaacgtggcggacccgcggagattccactgcctcaccatgggaggctctgacgccagccaggtacccaatggcaagaggatgaggacggcgttcactagcacgcaactcctggagctggagagagaattctcttccaacatgtacctgtctcgactccggaggattgaaatcgccacttacctgaacctgtcggagaagcaggtgaaaatctggtttcagaaccgccgagtgaagcacaagaaggaggggaagggcacgcagaggaacagtcacgcgggctgcaagtgcgtcgggagccaggtgcactacgcgcgctccgaggatgaggactccctgtcgccggcctcagccaacgatgacaaggagatttcccccttatgagggagggcctcctccctcacatcccccgctcct

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:170825 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:170825 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:170825 -> Biological process: GO:0002087 [regulation of respiratory gaseous exchange by neurological system process] evidence: IEA
            GeneID:170825 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:170825 -> Biological process: GO:0021527 [spinal cord association neuron differentiation] evidence: IEA
            GeneID:170825 -> Biological process: GO:0021575 [hindbrain morphogenesis] evidence: IEA
            GeneID:170825 -> Biological process: GO:0021798 [forebrain dorsal/ventral pattern formation] evidence: IEA
            GeneID:170825 -> Biological process: GO:0021889 [olfactory bulb interneuron differentiation] evidence: IEA
            GeneID:170825 -> Biological process: GO:0048665 [neuron fate specification] evidence: IEA
            GeneID:170825 -> Biological process: GO:0048853 [forebrain morphogenesis] evidence: IEA
            GeneID:170825 -> Biological process: GO:0060163 [subpallium neuron fate commitment] evidence: IEA
            GeneID:170825 -> Cellular component: GO:0005634 [nucleus] evidence: IEA