2025-06-13 22:16:04, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033178 1380 bp mRNA linear PRI 08-JUL-2013 DEFINITION Homo sapiens double homeobox 4 (DUX4), mRNA. ACCESSION NM_033178 XM_003960844 VERSION NM_033178.4 GI:489406996 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1380) AUTHORS Dandapat,A., Hartweck,L.M., Bosnakovski,D. and Kyba,M. TITLE Expression of the Human FSHD-Linked DUX4 Gene Induces Neurogenesis During Differentiation of Murine Embryonic Stem Cells JOURNAL Stem Cells Dev. (2013) In press PUBMED 23560660 REMARK Publication Status: Available-Online prior to print REFERENCE 2 (bases 1 to 1380) AUTHORS Krom,Y.D., Thijssen,P.E., Young,J.M., den Hamer,B., Balog,J., Yao,Z., Maves,L., Snider,L., Knopp,P., Zammit,P.S., Rijkers,T., van Engelen,B.G., Padberg,G.W., Frants,R.R., Tawil,R., Tapscott,S.J. and van der Maarel,S.M. TITLE Intrinsic epigenetic regulation of the D4Z4 macrosatellite repeat in a transgenic mouse model for FSHD JOURNAL PLoS Genet. 9 (4), E1003415 (2013) PUBMED 23593020 REFERENCE 3 (bases 1 to 1380) AUTHORS Dixit,M., Ansseau,E., Tassin,A., Winokur,S., Shi,R., Qian,H., Sauvage,S., Matteotti,C., van Acker,A.M., Leo,O., Figlewicz,D., Barro,M., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Chen,Y.W. TITLE DUX4, a candidate gene of facioscapulohumeral muscular dystrophy, encodes a transcriptional activator of PITX1 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 104 (46), 18157-18162 (2007) PUBMED 17984056 REMARK GeneRIF: up-regulation of both DUX4 and PITX1 in FSHD muscles may play critical roles in the molecular mechanisms of the disease REFERENCE 4 (bases 1 to 1380) AUTHORS Clapp,J., Mitchell,L.M., Bolland,D.J., Fantes,J., Corcoran,A.E., Scotting,P.J., Armour,J.A. and Hewitt,J.E. TITLE Evolutionary conservation of a coding function for D4Z4, the tandem DNA repeat mutated in facioscapulohumeral muscular dystrophy JOURNAL Am. J. Hum. Genet. 81 (2), 264-279 (2007) PUBMED 17668377 REFERENCE 5 (bases 1 to 1380) AUTHORS Kowaljow,V., Marcowycz,A., Ansseau,E., Conde,C.B., Sauvage,S., Matteotti,C., Arias,C., Corona,E.D., Nunez,N.G., Leo,O., Wattiez,R., Figlewicz,D., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Rosa,A.L. TITLE The DUX4 gene at the FSHD1A locus encodes a pro-apoptotic protein JOURNAL Neuromuscul. Disord. 17 (8), 611-623 (2007) PUBMED 17588759 REMARK GeneRIF: DUX4-mediated cell death contributes to the pathogenic pathway in facioscapulohumeral muscular dystrophy REFERENCE 6 (bases 1 to 1380) AUTHORS Ostlund,C., Garcia-Carrasquillo,R.M., Belayew,A. and Worman,H.J. TITLE Intracellular trafficking and dynamics of double homeodomain proteins JOURNAL Biochemistry 44 (7), 2378-2384 (2005) PUBMED 15709750 REMARK GeneRIF: Report shows that full-length DUX4 is actively transported into the nuclei of transfected C2C12 myoblasts, and that DUX4 homeodomains contain the signals required for this localization. REFERENCE 7 (bases 1 to 1380) AUTHORS Yip,D.J. and Picketts,D.J. TITLE Increasing D4Z4 repeat copy number compromises C2C12 myoblast differentiation JOURNAL FEBS Lett. 537 (1-3), 133-138 (2003) PUBMED 12606045 REFERENCE 8 (bases 1 to 1380) AUTHORS Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A., Frants,R.R., Collen,D. and Belayew,A. TITLE Active genes in junk DNA? Characterization of DUX genes embedded within 3.3 kb repeated elements JOURNAL Gene 264 (1), 51-57 (2001) PUBMED 11245978 REFERENCE 9 (bases 1 to 1380) AUTHORS Gabriels,J., Beckers,M.C., Ding,H., De Vriese,A., Plaisance,S., van der Maarel,S.M., Padberg,G.W., Frants,R.R., Hewitt,J.E., Collen,D. and Belayew,A. TITLE Nucleotide sequence of the partially deleted D4Z4 locus in a patient with FSHD identifies a putative gene within each 3.3 kb element JOURNAL Gene 236 (1), 25-32 (1999) PUBMED 10433963 REFERENCE 10 (bases 1 to 1380) AUTHORS Lee,J.H., Goto,K., Matsuda,C. and Arahata,K. TITLE Characterization of a tandemly repeated 3.3-kb KpnI unit in the facioscapulohumeral muscular dystrophy (FSHD) gene region on chromosome 4q35 JOURNAL Muscle Nerve Suppl 2, S6-S13 (1995) PUBMED 7739628 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC126281.3. This sequence is a reference standard in the RefSeqGene project. On May 7, 2013 this sequence version replaced gi:485464583. Summary: This gene is located within a D4Z4 repeat array in the subtelomeric region of chromosome 4q. The D4Z4 repeat is polymorphic in length; a similar D4Z4 repeat array has been identified on chromosome 10. Each D4Z4 repeat unit has an open reading frame (named DUX4) that encodes two homeoboxes; the repeat-array and ORF is conserved in other mammals. There is no evidence for transcription of this gene from standard cDNA libraries, however, RT-PCR and in vitro expression experiments indicate that the ORF is transcribed. The encoded protein has been reported to function as a transcriptional activator of paired-like homeodomain transcription factor 1 (PITX1; GeneID 5307). Contraction of the microsatellite repeat causes autosomal dominant facioscapulohumeral muscular dystrophy (FSHD). [provided by RefSeq, May 2013]. Sequence Note: This RefSeq record was created from genomic sequence data because no transcript data was available for the full length of the gene. The extent of this protein is supported by similar human proteins. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by available transcript and publication data. This gene is one of a cluster of highly similar DUX4 family members that are located within a D4Z4 repeat array in the subtelomeric region of chromosome 4q. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. COMPLETENESS: complete on the 5' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1380 AC126281.3 16074-17453 FEATURES Location/Qualifiers source 1..1380 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="4" /map="4q35" gene 1..1380 /gene="DUX4" /gene_synonym="DUX10" /note="double homeobox 4" /db_xref="GeneID:22947" /db_xref="HGNC:3082" /db_xref="MIM:606009" exon 1..1380 /gene="DUX4" /gene_synonym="DUX10" /inference="alignment:Splign:1.39.8" CDS 98..1372 /gene="DUX4" /gene_synonym="DUX10" /note="double homeobox protein 10; double homeobox protein 4/10" /codon_start=1 /product="double homeobox protein 4" /protein_id="NP_149418.4" /db_xref="GI:485464584" /db_xref="CCDS:CCDS54828.1" /db_xref="GeneID:22947" /db_xref="HGNC:3082" /db_xref="MIM:606009" /translation="
MALPTPSDSTLPAEARGRGRRRRLVWTPSQSEALRACFERNPYPGIATRERLAQAIGIPEPRVQIWFQNERSRQLRQHRRESRPWPGRRGPPEGRRKRTAVTGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHPGQGGRAPAQAGGLCSAAPGGGHPAPSWVAFAHTGAWGTGLPAPHVPCAPGALPQGAFVSQAARAAPALQPSQAAPAEGVSQPAPARGDFAYAAPAPPDGALSHPQAPRWPPHPGKSREDRDPQRDGLPGPCAVAQPGPAQAGPQGQGVLAPPTSQGSPWWGWGRGPQVAGAAWEPQAGAAPPPQPAPPDASASARQGQMQGIPAPSQALQEPAPWSALPCGLLLDELLASPEFLQQAQPLLETEAPGELEASEEAASLEAPLSEEEYRALLEEL
" misc_feature 170..331 /gene="DUX4" /gene_synonym="DUX10" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(170..172,290..292,299..304,311..313) /gene="DUX4" /gene_synonym="DUX10" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature order(173..175,224..226,242..244,281..283,287..292, 299..304,308..316,320..325) /gene="DUX4" /gene_synonym="DUX10" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 401..544 /gene="DUX4" /gene_synonym="DUX10" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:238039" misc_feature order(449..451,467..469,506..508,512..517,524..529, 533..541) /gene="DUX4" /gene_synonym="DUX10" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(515..517,524..529,536..538) /gene="DUX4" /gene_synonym="DUX10" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" ORIGIN
acctgccgcagtgcacagtccggctgaggtgcacgggagcccgccggcctctctctgcccgcgtccgtccgtgaaattccggccggggctcaccgcgatggccctcccgacaccctcggacagcaccctccccgcggaagcccggggacgaggacggcgacggagactcgtttggaccccgagccaaagcgaggccctgcgagcctgctttgagcggaacccgtacccgggcatcgccaccagagaacggctggcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaggcagcaccggcgggaatctcggccctggcccgggagacgcggcccgccagaaggccggcgaaagcggaccgccgtcaccggatcccagaccgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccgcccgggaggagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacagggtggcagggcgcccgcgcaggcaggcggcctgtgcagcgcggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagagggggtctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcacccgggcaaaagccgggaggaccgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:22947 -> Molecular function: GO:0000976 [transcription regulatory region sequence-specific DNA binding] evidence: IEA GeneID:22947 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:22947 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:22947 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.