Home |
Help |
Advanced search
2025-05-09 19:22:30, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033176 1619 bp mRNA linear PRI 15-MAR-2013 DEFINITION Homo sapiens NK2 homeobox 4 (NKX2-4), mRNA. ACCESSION NM_033176 XM_927653 XM_940179 VERSION NM_033176.1 GI:157426822 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1619) AUTHORS Deloukas,P., Matthews,L.H., Ashurst,J., Burton,J., Gilbert,J.G., Jones,M., Stavrides,G., Almeida,J.P., Babbage,A.K., Bagguley,C.L., Bailey,J., Barlow,K.F., Bates,K.N., Beard,L.M., Beare,D.M., Beasley,O.P., Bird,C.P., Blakey,S.E., Bridgeman,A.M., Brown,A.J., Buck,D., Burrill,W., Butler,A.P., Carder,C., Carter,N.P., Chapman,J.C., Clamp,M., Clark,G., Clark,L.N., Clark,S.Y., Clee,C.M., Clegg,S., Cobley,V.E., Collier,R.E., Connor,R., Corby,N.R., Coulson,A., Coville,G.J., Deadman,R., Dhami,P., Dunn,M., Ellington,A.G., Frankland,J.A., Fraser,A., French,L., Garner,P., Grafham,D.V., Griffiths,C., Griffiths,M.N., Gwilliam,R., Hall,R.E., Hammond,S., Harley,J.L., Heath,P.D., Ho,S., Holden,J.L., Howden,P.J., Huckle,E., Hunt,A.R., Hunt,S.E., Jekosch,K., Johnson,C.M., Johnson,D., Kay,M.P., Kimberley,A.M., King,A., Knights,A., Laird,G.K., Lawlor,S., Lehvaslaiho,M.H., Leversha,M., Lloyd,C., Lloyd,D.M., Lovell,J.D., Marsh,V.L., Martin,S.L., McConnachie,L.J., McLay,K., McMurray,A.A., Milne,S., Mistry,D., Moore,M.J., Mullikin,J.C., Nickerson,T., Oliver,K., Parker,A., Patel,R., Pearce,T.A., Peck,A.I., Phillimore,B.J., Prathalingam,S.R., Plumb,R.W., Ramsay,H., Rice,C.M., Ross,M.T., Scott,C.E., Sehra,H.K., Shownkeen,R., Sims,S., Skuce,C.D., Smith,M.L., Soderlund,C., Steward,C.A., Sulston,J.E., Swann,M., Sycamore,N., Taylor,R., Tee,L., Thomas,D.W., Thorpe,A., Tracey,A., Tromans,A.C., Vaudin,M., Wall,M., Wallis,J.M., Whitehead,S.L., Whittaker,P., Willey,D.L., Williams,L., Williams,S.A., Wilming,L., Wray,P.W., Hubbard,T., Durbin,R.M., Bentley,D.R., Beck,S. and Rogers,J. TITLE The DNA sequence and comparative analysis of human chromosome 20 JOURNAL Nature 414 (6866), 865-871 (2001) PUBMED 11780052 REFERENCE 2 (bases 1 to 1619) AUTHORS Wang,C.C., Brodnicki,T., Copeland,N.G., Jenkins,N.A. and Harvey,R.P. TITLE Conserved linkage of NK-2 homeobox gene pairs Nkx2-2/2-4 and Nkx2-1/2-9 in mammals JOURNAL Mamm. Genome 11 (6), 466-468 (2000) PUBMED 10818213 REFERENCE 3 (bases 1 to 1619) AUTHORS Price,M., Lazzaro,D., Pohl,T., Mattei,M.G., Ruther,U., Olivo,J.C., Duboule,D. and Di Lauro,R. TITLE Regional expression of the homeobox gene Nkx-2.2 in the developing mammalian forebrain JOURNAL Neuron 8 (2), 241-255 (1992) PUBMED 1346742 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AL158013.25. On or before Sep 23, 2007 this sequence version replaced gi:113428840, gi:113428988. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-452 AL158013.25 43546-43997 c 453-1619 AL158013.25 41955-43121 c FEATURES Location/Qualifiers source 1..1619 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="20" /map="20p11.22" gene 1..1619 /gene="NKX2-4" /gene_synonym="NKX2.4; NKX2D" /note="NK2 homeobox 4" /db_xref="GeneID:644524" /db_xref="HGNC:7837" /db_xref="MIM:607808" exon 1..452 /gene="NKX2-4" /gene_synonym="NKX2.4; NKX2D" /inference="alignment:Splign:1.39.8" variation complement(5) /gene="NKX2-4" /gene_synonym="NKX2.4; NKX2D" /replace="a" /replace="c" /db_xref="dbSNP:200359338" CDS 11..1075 /gene="NKX2-4" /gene_synonym="NKX2.4; NKX2D" /note="NK2 transcription factor homolog D; NK2 transcription factor related, locus 4" /codon_start=1 /product="homeobox protein Nkx-2.4" /protein_id="NP_149416.1" /db_xref="GI:157426823" /db_xref="CCDS:CCDS42855.1" /db_xref="GeneID:644524" /db_xref="HGNC:7837" /db_xref="MIM:607808" /translation="
MSLSPKHTTPFSVSDILSPIEETYKKFSGAMDGAPPGLGAPLGAAAAYRAPPPGPSSQAATVAGMQPSHAMAGHNAAAAAAAAAAAAAAAATYHMPPGVSQFPHGAMGSYCNGGLGNMGELPAYTDGMRGGAATGWYGANPDPRYSSISRFMGPSAGVNVAGMGSLTGIADAAKSLGPLHAAAAAAAPRRKRRVLFSQAQVYELERRFKQQKYLSAPEREHLASMIHLTPTQVKIWFQNHRYKMKRQAKDKAAQQLQQEGGLGPPPPPPPSPRRVAVPVLVKDGKPCQNGASTPTPGQAGPQPPAPTPAPELEELSPSPPALHGPGGGLAALDAAAGEYSGGVLGANLLYGRTW
"
misc_feature 578..742
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/note="Homeodomain; DNA binding domains involved in the
transcriptional regulation of key eukaryotic developmental
processes; may bind to DNA as monomers or as homo- and/or
heterodimers, in a sequence-specific manner; Region:
homeodomain; cd00086"
/db_xref="CDD:28970"
misc_feature order(578..592,596..598,647..649,665..667,704..706,
710..715,722..727,731..739)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:28970"
misc_feature order(584..586,593..595,713..715,722..727,734..736)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/note="specific DNA base contacts [nucleotide binding];
other site"
/db_xref="CDD:28970"
variation complement(31)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="g"
/db_xref="dbSNP:368288200"
variation complement(56)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:375499093"
variation complement(226)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:76085962"
variation complement(336)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="g"
/db_xref="dbSNP:201962740"
exon 453..1619
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/inference="alignment:Splign:1.39.8"
variation complement(541)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="t"
/db_xref="dbSNP:199747643"
variation complement(573)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="t"
/db_xref="dbSNP:370549869"
variation complement(643)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:371741137"
variation complement(654)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="t"
/db_xref="dbSNP:367598502"
variation complement(667)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="t"
/db_xref="dbSNP:375642949"
variation complement(687)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="g"
/replace="t"
/db_xref="dbSNP:371025178"
variation complement(709)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="g"
/db_xref="dbSNP:181422340"
variation complement(730)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="t"
/db_xref="dbSNP:199964105"
variation complement(733)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:376119111"
variation complement(763)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:6035869"
variation complement(1016)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="g"
/db_xref="dbSNP:112136447"
variation complement(1087)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="t"
/db_xref="dbSNP:373054893"
variation complement(1111)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="c"
/replace="g"
/db_xref="dbSNP:369376945"
variation complement(1113)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="g"
/replace="t"
/db_xref="dbSNP:376075030"
variation complement(1126)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:372702328"
variation complement(1349)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:369880500"
variation complement(1426)
/gene="NKX2-4"
/gene_synonym="NKX2.4; NKX2D"
/replace="a"
/replace="g"
/db_xref="dbSNP:375954224"
ORIGIN
ccgccgagccatgtcgttgagcccaaagcacacgacgcccttctccgtgtccgacatcctgagccccatcgaggagacctacaagaagttcagcggcgccatggacggcgcgccacccggcctgggggcgcccctgggggccgcggccgcctaccgcgcgccgccacctgggccctcctcgcaggcggcgaccgtggcgggcatgcagccttctcacgccatggcgggtcacaacgcggcggccgcggcggcggcggcagcagctgcggcggcggcggccgccacctaccacatgccgcccggcgtctcgcagttcccgcacggcgccatgggcagctactgcaacggcggcctgggcaacatgggcgagctgcccgcctacacggacggcatgcggggcggcgcggccaccggctggtacggcgccaacccggacccacgctactcgtcaatctccaggttcatggggccgtcggcgggcgtgaatgtggccggcatggggtcgctgaccggcatcgcggacgccgccaagtcgctgggcccgctgcacgcggcggcggcggcagccgctccgcgaaggaagcgccgcgtgctcttctcgcaggcgcaggtctacgagctggagcggcgcttcaagcagcagaagtacctgtcggcgcccgagcgcgagcacctggccagcatgatccacctgacgcccacgcaggtcaagatctggttccagaaccaccggtacaagatgaaacggcaggccaaggacaaggcggcgcagcagctgcagcaggagggcggcctgggcccgccgccgcctccgccgccgtccccgcgccgcgtggcggtgcctgtgctggtcaaggacggcaagccgtgccagaacggcgccagcacgcccacccccggccaggccggtccgcagccgccggccccgacgccagcacctgagctggaggagctgtcgcccagcccacccgcgctgcacggcccggggggcggcctggcggccctggacgcggccgccggggagtacagcggcggcgtcctgggcgccaacctgctctatggcaggacgtggtgacagcgagggcgccccggggctaggtcctggtgcacccgaagggtctgcaagaaactgctagaacggatgggggaggcatgcgaaaaccgactcgcgcgtgtaaactgcgattcaaaacgaaccggtctcagagaggagcaggctgtgaacctcttgctgggggcgggggacagcgacagcccggaaaccgagtagtgtaacattatgccacgaggctttgaggtggtgattttctcctcctagaagttcttaaatgacgcgaaaaggtggagaagttcacacggcattcttaactacagctctcaaagttggaaactttgttggcgtttgtaactataaaaatcaacccagctttaacaatcagtcctttttgaagtggaatttatcttgggagattaattttcgaagggccccctaagtgcaatttcattaatgtttgattgaaagtaaattgaagtgtagctcaaggtggatcatacacatagcaacattattgcagaggaattattgccatttaggtaatagagcaatggaatcaaaataa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:644524 -> Molecular function: GO:0003674 [molecular_function] evidence: ND
GeneID:644524 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:644524 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:644524 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
GeneID:644524 -> Biological process: GO:0008150 [biological_process] evidence: ND
GeneID:644524 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
GeneID:644524 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.