LOCUS       NM_022716               3999 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens paired related homeobox 1 (PRRX1), transcript variant
            pmx-1b, mRNA.
ACCESSION   NM_022716
VERSION     NM_022716.2  GI:56699460
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3999)
  AUTHORS   Ocana,O.H., Corcoles,R., Fabra,A., Moreno-Bueno,G., Acloque,H.,
            Vega,S., Barrallo-Gimeno,A., Cano,A. and Nieto,M.A.
  TITLE     Metastatic colonization requires the repression of the
            epithelial-mesenchymal transition inducer Prrx1
  JOURNAL   Cancer Cell 22 (6), 709-724 (2012)
   PUBMED   23201163
  REMARK    GeneRIF: The homeobox factor Prrx1 is an EMT inducer conferring
            migratory and invasive properties.
            GeneRIF: We show that the homeobox factor Prrx1 is an EMT inducer
            conferring migratory and invasive properties. The loss of Prrx1 is
            required for cancer cells to metastasize in vivo, which revert to
            the epithelial phenotype concomitant with the acquisition of stem
            cell properties.
REFERENCE   2  (bases 1 to 3999)
  AUTHORS   Turner,S.T., Bailey,K.R., Schwartz,G.L., Chapman,A.B., Chai,H.S.
            and Boerwinkle,E.
  TITLE     Genomic association analysis identifies multiple loci influencing
            antihypertensive response to an angiotensin II receptor blocker
  JOURNAL   Hypertension 59 (6), 1204-1211 (2012)
   PUBMED   22566498
REFERENCE   3  (bases 1 to 3999)
  AUTHORS   Ellinor,P.T., Lunetta,K.L., Albert,C.M., Glazer,N.L., Ritchie,M.D.,
            Smith,A.V., Arking,D.E., Muller-Nurasyid,M., Krijthe,B.P.,
            Lubitz,S.A., Bis,J.C., Chung,M.K., Dorr,M., Ozaki,K., Roberts,J.D.,
            Smith,J.G., Pfeufer,A., Sinner,M.F., Lohman,K., Ding,J.,
            Smith,N.L., Smith,J.D., Rienstra,M., Rice,K.M., Van Wagoner,D.R.,
            Magnani,J.W., Wakili,R., Clauss,S., Rotter,J.I., Steinbeck,G.,
            Launer,L.J., Davies,R.W., Borkovich,M., Harris,T.B., Lin,H.,
            Volker,U., Volzke,H., Milan,D.J., Hofman,A., Boerwinkle,E.,
            Chen,L.Y., Soliman,E.Z., Voight,B.F., Li,G., Chakravarti,A.,
            Kubo,M., Tedrow,U.B., Rose,L.M., Ridker,P.M., Conen,D., Tsunoda,T.,
            Furukawa,T., Sotoodehnia,N., Xu,S., Kamatani,N., Levy,D.,
            Nakamura,Y., Parvez,B., Mahida,S., Furie,K.L., Rosand,J.,
            Muhammad,R., Psaty,B.M., Meitinger,T., Perz,S., Wichmann,H.E.,
            Witteman,J.C., Kao,W.H., Kathiresan,S., Roden,D.M.,
            Uitterlinden,A.G., Rivadeneira,F., McKnight,B., Sjogren,M.,
            Newman,A.B., Liu,Y., Gollob,M.H., Melander,O., Tanaka,T.,
            Stricker,B.H., Felix,S.B., Alonso,A., Darbar,D., Barnard,J.,
            Chasman,D.I., Heckbert,S.R., Benjamin,E.J., Gudnason,V. and Kaab,S.
  TITLE     Meta-analysis identifies six new susceptibility loci for atrial
            fibrillation
  JOURNAL   Nat. Genet. 44 (6), 670-675 (2012)
   PUBMED   22544366
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 3999)
  AUTHORS   Herman,S., Delio,M., Morrow,B. and Samanich,J.
  TITLE     Agnathia-otocephaly complex: a case report and examination of the
            OTX2 and PRRX1 genes
  JOURNAL   Gene 494 (1), 124-129 (2012)
   PUBMED   22198066
  REMARK    GeneRIF: Mutation analysis was performed after sequencing the
            entire coding regions of OTX2 and PRRX1 genes isolated from the
            proband and his parents. After thorough analysis, no DNA variations
            were detected.
REFERENCE   5  (bases 1 to 3999)
  AUTHORS   Liborio,T.N., Acquafreda,T., Matizonkas-Antonio,L.F.,
            Silva-Valenzuela,M.G., Ferraz,A.R. and Nunes,F.D.
  TITLE     In situ hybridization detection of homeobox genes reveals distinct
            expression patterns in oral squamous cell carcinomas
  JOURNAL   Histopathology 58 (2), 225-233 (2011)
   PUBMED   21323949
  REMARK    GeneRIF: HOXA7, PIXT1 and PRRX1 homeobox genes have different
            patterns of expression in oral squamous cell carcinomas depending
            on its histological features.
REFERENCE   6  (bases 1 to 3999)
  AUTHORS   Kataoka,K., Yoshitomo-Nakagawa,K., Shioda,S. and Nishizawa,M.
  TITLE     A set of Hox proteins interact with the Maf oncoprotein to inhibit
            its DNA binding, transactivation, and transforming activities
  JOURNAL   J. Biol. Chem. 276 (1), 819-826 (2001)
   PUBMED   11036080
REFERENCE   7  (bases 1 to 3999)
  AUTHORS   Nakamura,T., Yamazaki,Y., Hatano,Y. and Miura,I.
  TITLE     NUP98 is fused to PMX1 homeobox gene in human acute myelogenous
            leukemia with chromosome translocation t(1;11)(q23;p15)
  JOURNAL   Blood 94 (2), 741-747 (1999)
   PUBMED   10397741
REFERENCE   8  (bases 1 to 3999)
  AUTHORS   Grueneberg,D.A., Henry,R.W., Brauer,A., Novina,C.D., Cheriyath,V.,
            Roy,A.L. and Gilman,M.
  TITLE     A multifunctional DNA-binding protein that promotes the formation
            of serum response factor/homeodomain complexes: identity to TFII-I
  JOURNAL   Genes Dev. 11 (19), 2482-2493 (1997)
   PUBMED   9334314
REFERENCE   9  (bases 1 to 3999)
  AUTHORS   Grueneberg,D.A., Simon,K.J., Brennan,K. and Gilman,M.
  TITLE     Sequence-specific targeting of nuclear signal transduction pathways
            by homeodomain proteins
  JOURNAL   Mol. Cell. Biol. 15 (6), 3318-3326 (1995)
   PUBMED   7760827
REFERENCE   10 (bases 1 to 3999)
  AUTHORS   Grueneberg,D.A., Natesan,S., Alexandre,C. and Gilman,M.Z.
  TITLE     Human and Drosophila homeodomain proteins that enhance the
            DNA-binding activity of serum response factor
  JOURNAL   Science 257 (5073), 1089-1095 (1992)
   PUBMED   1509260
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC074993.2, AV750422.1 and
            Z97200.1.
            On Dec 17, 2004 this sequence version replaced gi:12707576.
            
            Summary: The DNA-associated protein encoded by this gene is a
            member of the paired family of homeobox proteins localized to the
            nucleus. The protein functions as a transcription co-activator,
            enhancing the DNA-binding activity of serum response factor, a
            protein required for the induction of genes by growth and
            differentiation factors. The protein regulates muscle creatine
            kinase, indicating a role in the establishment of diverse
            mesodermal muscle types. Alternative splicing yields two isoforms
            that differ in abundance and expression patterns. [provided by
            RefSeq, Jul 2008].
            
            Transcript Variant: This variant (pmx-1b) encodes the longer
            isoform (pmx-1b).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC074993.2, CN410183.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-26                BC074993.2         1-26
            27-28               AV750422.1         329-330
            29-829              BC074993.2         29-829
            830-3999            Z97200.1           40484-43653         c
FEATURES             Location/Qualifiers
     source          1..3999
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q24"
     gene            1..3999
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="paired related homeobox 1"
                     /db_xref="GeneID:5396"
                     /db_xref="HGNC:9142"
                     /db_xref="HPRD:01337"
                     /db_xref="MIM:167420"
     STS             1..829
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /db_xref="UniSTS:482178"
     exon            1..288
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       10
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77911930"
     variation       19
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375142985"
     variation       26
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368044377"
     variation       35
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79715821"
     CDS             48..785
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="isoform pmx-1b is encoded by transcript variant
                     pmx-1b; homeobox protein PHOX1; paired mesoderm homeo box
                     1; paired mesoderm homeobox protein 1; paired mesoderm
                     homeobox 1 isoform pmx-1b; paired-related homeobox protein
                     1"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 1 isoform
                     pmx-1b"
                     /protein_id="NP_073207.1"
                     /db_xref="GI:12707577"
                     /db_xref="CCDS:CCDS1290.1"
                     /db_xref="GeneID:5396"
                     /db_xref="HGNC:9142"
                     /db_xref="HPRD:01337"
                     /db_xref="MIM:167420"
                     /translation="

MTSSYGHVLERQPALGGRLDSPGNLDTLQAKKNFSVSHLLDLEEAGDMVAAQADENVGEAGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLANKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYSAMATYSATCANNSPAQGINMANSIANLRLKAKEYSLQRNQVPTVN

"
     misc_feature    342..506
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(342..344,348..350,399..401,417..419,456..458,
                     462..467,474..479,483..491,495..500)
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(345..347,465..467,474..479,486..488)
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    702..755
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="OAR domain; Region: OAR; pfam03826"
                     /db_xref="CDD:146451"
     misc_feature    711..752
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P54821.2);
                     Region: OAR"
     variation       62
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138970767"
     variation       83
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377126967"
     variation       85
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200885791"
     variation       96
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370044964"
     variation       122
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199691593"
     STS             138..785
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="Prrx1"
                     /db_xref="UniSTS:525268"
     variation       151
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373448980"
     variation       197
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376351453"
     variation       215
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370202431"
     variation       232
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74674242"
     variation       253
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201153811"
     variation       257
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372174969"
     variation       284
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200693185"
     exon            289..464
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       290
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370699898"
     variation       316
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79567938"
     variation       322
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147354859"
     variation       326
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374406599"
     variation       353
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34501887"
     variation       357
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75715275"
     variation       385
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387906667"
     variation       401
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200583557"
     variation       455
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377339646"
     exon            465..646
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       513
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147184063"
     variation       519
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149731143"
     variation       550
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201661471"
     variation       560
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374262561"
     variation       570
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201365132"
     variation       612
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372098442"
     exon            647..3999
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       647
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151333816"
     variation       661
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368848007"
     variation       681
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373373102"
     variation       687
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140550541"
     STS             717..993
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="G15917"
                     /db_xref="UniSTS:21147"
     variation       771
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201359953"
     variation       796
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139568481"
     variation       808
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371029463"
     variation       821
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200135594"
     variation       878
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6663373"
     variation       955
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375871578"
     variation       1076
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6666030"
     variation       1143..1144
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tata"
                     /db_xref="dbSNP:10644708"
     variation       1144..1153
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tatatatata"
                     /db_xref="dbSNP:142852183"
     variation       1144..1149
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tatata"
                     /db_xref="dbSNP:112340262"
     variation       1144..1145
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tata"
                     /db_xref="dbSNP:66515062"
     variation       1154..1159
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tatata"
                     /db_xref="dbSNP:72198615"
     variation       1155..1160
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="atatat"
                     /db_xref="dbSNP:66518766"
     variation       1161..1170
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="atatatatat"
                     /db_xref="dbSNP:67734884"
     variation       1162..1163
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tata"
                     /db_xref="dbSNP:71790118"
     variation       1165..1170
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="atatat"
                     /db_xref="dbSNP:61148079"
     variation       1212
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:180995287"
     variation       1357..1358
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:58473244"
     variation       1550
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144145873"
     variation       1813
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369414337"
     variation       1814
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:41272503"
     STS             1816..2571
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="PRRX1_2266"
                     /db_xref="UniSTS:280930"
     variation       1905
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151019671"
     variation       2011
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186075523"
     variation       2045
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376968825"
     variation       2070
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140894020"
     variation       2093
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188229975"
     variation       2097
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73036701"
     variation       2125
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370208404"
     variation       2139..2140
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35591271"
     variation       2156
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181413858"
     variation       2260
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149709697"
     variation       2261
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377218637"
     variation       2368
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185691611"
     variation       2615
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190652230"
     variation       2645
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3203926"
     variation       2668
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145568344"
     variation       2701
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74123171"
     variation       2706
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2227207"
     variation       2737
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76427450"
     variation       2749
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182885405"
     variation       2888..2889
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34160248"
     variation       2891
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2213750"
     variation       2967
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41272505"
     variation       2997
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11552914"
     variation       2998
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187465183"
     variation       3021
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141178877"
     variation       3048
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115848619"
     variation       3051
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34963551"
     variation       3133
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3820416"
     variation       3135
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183965225"
     variation       3293
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187706632"
     variation       3479
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146969525"
     variation       3565
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114604454"
     variation       3661
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115492463"
     variation       3723
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112446424"
     variation       3734
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143805931"
     variation       3804
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191237385"
     STS             3855..3968
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="G31141"
                     /db_xref="UniSTS:18405"
     variation       3907
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182690267"
     variation       3971
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148159513"
     polyA_signal    3977..3982
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
     variation       3987..3989
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:373284840"
     variation       3989
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3177154"
ORIGIN      

tgattcgagcgggaagaggggggtgggtgggatcggtgggggagaccatgacctccagctacgggcacgttctggagcggcaaccggcgctgggcggccgcttggacagcccgggcaacctcgacaccctgcaggcgaaaaagaacttctccgtcagtcacctgctagacctggaggaagccggggacatggtggcggcacaggcggatgagaacgtgggcgaggctggccggagcctgctggagtcgccgggactcaccagcggcagcgacaccccgcagcaggacaatgaccagctgaactcagaagaaaaaaagaagagaaagcagcgaaggaataggacaaccttcaatagcagccagctgcaggctttggagcgtgtctttgagcggacacactatcctgatgcttttgtgcgagaagaccttgcccgccgggtgaacctcaccgaggcgagagtgcaggtgtggtttcagaaccgaagagccaagttccgcaggaatgagagagccatgctagccaataaaaacgcttccctcctcaaatcctactcaggagacgtgactgctgtggagcagcccatcgtacctcgtcctgctccgagacccaccgattatctctcctgggggacagcgtctccgtacagcgccatggctacttattctgccacatgtgccaacaatagccctgcacagggcatcaacatggccaacagcattgccaacctgagactgaaggccaaggaatatagtttacagaggaaccaggtgccaacagtcaactgaggaaaaaaaataattaaacaggcctaagaagaaatcaaaaaccataagacacctatcctgctctgttatttcttcatctgctggggggaaaaagtaaattacaaacaaacaaacaaagcagaactaaaatattgggaccatggcagagaaaagcaggagaggagcaaaatgaaaattagttaacaaatgttcctcctccctctgggataccaccaccacttgtttctgtgtgtgtttattttgtttttctttcattcatgctttgcttaatgtactccaggcttcttcagataggttcagcccacccacccccatgattgtatgaagttttaaaaaaaactacagcagccaaagaaactatatatatatatatatatatatatatccagaatgattgcctctactgtcctcattgacttgtttgaaccttagtgccttaccctgtcctcttcccagttctctttatagaagctctaggagctttcgaaaagccaaagtctttctgaagaatctgtgctggacagacataattccctttctcattgtctccatctttgttggtcatggtaaggtttttccatcagcctctgaaaaaatagttgtgcacaacatctgctcactggactgtctgatccaatgtaattggctgcgtctggctaattctaagcactaaagtctacatctaagctatagatttaagcttgaagctacagattatatcactatcaccaccacccctcaccctatgcaatcaatcaatcaatcatcttaagttaaagatatttgttgtctttgaatgatttgctgtcacagactatttggtagaagaaatatttttcacctgagagaggaagagaaatttctctagtaacacaaagagtgagttctaaaaggcatgcccacatctctttcgtgccttaaggatagtgagatgcacacttatatatatactgtatatatttatatatttatatatatatttcatatatatatataatattgcaagcttaagtttgcaatttcccaaacaatacaaaaagcaaattacacaccctcaccactgttcttatctctatagtgatgaaacattaattagggatcttgctgcttttctttttctacacgaagttttcattaaagccacagaataattgatagggcagctgtttgagaacaggtcccattttcacattagggctttaaatgaattagaaactatttgaggctataaaaatgtccttgagtttggagcctgagctctggtgaaatgctgatacatctgatctatcatgggaattgcagttagagagagtaaggaataccatttagtcatctatccgttcttcacttagcaggaatatgaaagaaaggcacatgtttaagaggaatacctaaaggtttttctaaattccaacatttaaaaggcaattgtgggctatttttattttttaatattttgaaataaagtttagtgtctagggctgggagccaggactgatcttccatttctttttctttgttcccagccatgcttttgtaacttgccaggtggacttgaccaactacattaccatgctgtgcctcagtttacccatttgtaaaatgggattaataatacttacctacctcacaggggtgttgtgaggctctattcatttgctcctttattctttcctgtattctctgtatgtccagcactttgtagccatgggaggaaagggactataaaagtgtacaatgttaatggaatgatacggtacctgaaagccttgttttctagtaagaaaatgctaccttgctgtacatacttataaccttgtatttggaaatgagaaataggtttatattttcagatctctcaaaaatcacatcatttgaccaaagaataatttaagacacatagaacagatttttttaatttatattttcatcctgaccagcttagttctaataatttttagttgtgagtgattaaaaaactttggatcaattttggtcaaacatgccaactttgtagtctgagtgacaggcaaggatttttgggtttaagatgcacttttagcacacatttgtatttcccttggcatatcagattgagctaatggtgatgttatttcaatctaacagccaccaatctgaaattgtatttcaaatgttgattctgtagttctttaaataataatgaagctcatcttatacattttgctttcaccaattgattccttcttcttttagcccactattaaaacatttcttactgaatggttcatgtaggcttgctgaacagcacgcattacttgcttcctgaagagttcccccattcatccatttgtcccattagttgctgtggattatcaagttttgaaggaactgtacatcccaacagactgaaacattctaagtgaaatgagtataatccaagtaactggtgaactttggaggtttggagcttgaagagaatggctaagaagatttgaattatagggagggaacagaaatcatacatgaaaaggttttactgagaaggggaaaaccttagatagagggacatgtgaaacaaaatcatttgaaattttgattcagacatccatttccagtggcaaacagcaaagcctgaacccataaacccaaatgataggtgaagttgggtggttttatccaatgtctcaagcaagcaatgtctgggaatatcatagagtaacaagtgctggtcagccaaagaaacattcactgctggtgaaccaataccataagcatgtattatctaagcacttgatcaagaaatatacatgttgtacaagctctcaattttgttcatttattatcaaatttttaaaatacaagtttggtatgtgatttggaaaagatgccttctggatcttaagccagttgtcagtggaggtcctcagggctgcaaatgtcaagacataaccctgttcctcaccatcatgataccagatacaggtgaatacataggaactatctgcctgtgtcctcaatctcccttcaaacaagatgctgatttgtagggtacttggcaggttaaattaaaccagaagaggtgacttaataaaaaagggaatgacatttagggtataaagatctcataagaaatgtaatatgtaaattatatcttgctttatgttgtaaaatatacattgtttgcgctagaatagaaatgatttcttttcaataaaaagaaagaaggactcta

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5396 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:5396 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS
            GeneID:5396 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:5396 -> Molecular function: GO:0071837 [HMG box domain binding] evidence: IEA
            GeneID:5396 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:5396 -> Biological process: GO:0002053 [positive regulation of mesenchymal cell proliferation] evidence: IEA
            GeneID:5396 -> Biological process: GO:0030326 [embryonic limb morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0042472 [inner ear morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0042474 [middle ear morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0045880 [positive regulation of smoothened signaling pathway] evidence: IEA
            GeneID:5396 -> Biological process: GO:0048701 [embryonic cranial skeleton morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0048844 [artery morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0051216 [cartilage development] evidence: IEA
            GeneID:5396 -> Biological process: GO:0060021 [palate development] evidence: IEA
            GeneID:5396 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:5396 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA