Home |
Help |
Advanced search
2025-05-09 19:37:39, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_021101 3452 bp mRNA linear PRI 16-JUN-2013
DEFINITION Homo sapiens claudin 1 (CLDN1), mRNA.
ACCESSION NM_021101
VERSION NM_021101.4 GI:296785063
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3452)
AUTHORS Qin,W., Ren,Q., Liu,T., Huang,Y. and Wang,J.
TITLE MicroRNA-155 is a novel suppressor of ovarian cancer-initiating
cells that targets CLDN1
JOURNAL FEBS Lett. 587 (9), 1434-1439 (2013)
PUBMED 23523916
REMARK GeneRIF: miR-155 may prevent tumorigenesis in human ovarian cancer
through downregulation of CLDN1
REFERENCE 2 (bases 1 to 3452)
AUTHORS Fortier,A.M., Asselin,E. and Cadrin,M.
TITLE Keratin 8 and 18 loss in epithelial cancer cells increases
collective cell migration and cisplatin sensitivity through
claudin1 up-regulation
JOURNAL J. Biol. Chem. 288 (16), 11555-11571 (2013)
PUBMED 23449973
REMARK GeneRIF: Keratin 8 and 18 loss in epithelial cancer cells increases
collective cell migration and cisplatin sensitivity through
claudin1 up-regulation.
REFERENCE 3 (bases 1 to 3452)
AUTHORS Singh,A.B., Sharma,A. and Dhawan,P.
TITLE Claudin-1 expression confers resistance to anoikis in colon cancer
cells in a Src-dependent manner
JOURNAL Carcinogenesis 33 (12), 2538-2547 (2012)
PUBMED 22941059
REMARK GeneRIF: Claudin-1 expression confers resistance to anoikis in
colon cancer cells in a Src-dependent manner.
REFERENCE 4 (bases 1 to 3452)
AUTHORS Davis,C., Harris,H.J., Hu,K., Drummer,H.E., McKeating,J.A.,
Mullins,J.G. and Balfe,P.
TITLE In silico directed mutagenesis identifies the CD81/claudin-1
hepatitis C virus receptor interface
JOURNAL Cell. Microbiol. 14 (12), 1892-1903 (2012)
PUBMED 22897233
REMARK GeneRIF: Fluorescent Resonance Energy Transfer studies confirm a
role for these CD81 residues in claudin-1 association and Hepatitis
C virus infection.
REFERENCE 5 (bases 1 to 3452)
AUTHORS Bhat,A.A., Sharma,A., Pope,J., Krishnan,M., Washington,M.K.,
Singh,A.B. and Dhawan,P.
TITLE Caudal homeobox protein Cdx-2 cooperates with Wnt pathway to
regulate claudin-1 expression in colon cancer cells
JOURNAL PLoS ONE 7 (6), E37174 (2012)
PUBMED 22719836
REMARK GeneRIF: conclude that homeodomain transcription factors Cdx1, Cdx2
and GATA4 regulate claudin-1 gene expression in human colon cancer
cells
REFERENCE 6 (bases 1 to 3452)
AUTHORS Itoh,M., Furuse,M., Morita,K., Kubota,K., Saitou,M. and Tsukita,S.
TITLE Direct binding of three tight junction-associated MAGUKs, ZO-1,
ZO-2, and ZO-3, with the COOH termini of claudins
JOURNAL J. Cell Biol. 147 (6), 1351-1363 (1999)
PUBMED 10601346
REFERENCE 7 (bases 1 to 3452)
AUTHORS Furuse,M., Sasaki,H. and Tsukita,S.
TITLE Manner of interaction of heterogeneous claudin species within and
between tight junction strands
JOURNAL J. Cell Biol. 147 (4), 891-903 (1999)
PUBMED 10562289
REFERENCE 8 (bases 1 to 3452)
AUTHORS Swisshelm,K., Machl,A., Planitzer,S., Robertson,R., Kubbies,M. and
Hosier,S.
TITLE SEMP1, a senescence-associated cDNA isolated from human mammary
epithelial cells, is a member of an epithelial membrane protein
superfamily
JOURNAL Gene 226 (2), 285-295 (1999)
PUBMED 9931503
REFERENCE 9 (bases 1 to 3452)
AUTHORS Morita,K., Furuse,M., Fujimoto,K. and Tsukita,S.
TITLE Claudin multigene family encoding four-transmembrane domain protein
components of tight junction strands
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 96 (2), 511-516 (1999)
PUBMED 9892664
REFERENCE 10 (bases 1 to 3452)
AUTHORS Furuse,M., Fujita,K., Hiiragi,T., Fujimoto,K. and Tsukita,S.
TITLE Claudin-1 and -2: novel integral membrane proteins localizing at
tight junctions with no sequence similarity to occludin
JOURNAL J. Cell Biol. 141 (7), 1539-1550 (1998)
PUBMED 9647647
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DA907275.1, AY358652.1 and
AC009520.16.
This sequence is a reference standard in the RefSeqGene project.
On May 25, 2010 this sequence version replaced gi:21536297.
Summary: Tight junctions represent one mode of cell-to-cell
adhesion in epithelial or endothelial cell sheets, forming
continuous seals around cells and serving as a physical barrier to
prevent solutes and water from passing freely through the
paracellular space. These junctions are comprised of sets of
continuous networking strands in the outwardly facing cytoplasmic
leaflet, with complementary grooves in the inwardly facing
extracytoplasmic leaflet. The protein encoded by this gene, a
member of the claudin family, is an integral membrane protein and a
component of tight junction strands. Loss of function mutations
result in neonatal ichthyosis-sclerosing cholangitis syndrome.
[provided by RefSeq, Jul 2008].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF101051.1, AY358652.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-228 DA907275.1 1-228
229-1136 AY358652.1 207-1114
1137-3452 AC009520.16 10690-13005 c
FEATURES Location/Qualifiers
source 1..3452
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3q28-q29"
gene 1..3452
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/note="claudin 1"
/db_xref="GeneID:9076"
/db_xref="HGNC:2032"
/db_xref="HPRD:04760"
/db_xref="MIM:603718"
exon 1..463
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="alignment:Splign:1.39.8"
misc_feature 130..132
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/note="upstream in-frame stop codon"
CDS 241..876
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/note="senescence-associated epithelial membrane protein
1"
/codon_start=1
/product="claudin-1"
/protein_id="NP_066924.1"
/db_xref="GI:10863887"
/db_xref="CCDS:CCDS3295.1"
/db_xref="GeneID:9076"
/db_xref="HGNC:2032"
/db_xref="HPRD:04760"
/db_xref="MIM:603718"
/translation="
MANAGLQLLGFILAFLGWIGAIVSTALPQWRIYSYAGDNIVTAQAMYEGLWMSCVSQSTGQIQCKVFDSLLNLSSTLQATRALMVVGILLGVIAIFVATVGMKCMKCLEDDEVQKMRMAVIGGAIFLLAGLAILVATAWYGNRIVQEFYDPMTPVNARYEFGQALFTGWAAASLCLLGGALLCCSCPRKTTSYPTPRPYPKPAPSSGKDYV
"
misc_feature 253..747
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; cl15797"
/db_xref="CDD:210197"
misc_feature 262..324
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O95832.1);
transmembrane region"
misc_feature 484..546
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O95832.1);
transmembrane region"
misc_feature 586..648
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O95832.1);
transmembrane region"
misc_feature 730..792
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O95832.1);
transmembrane region"
misc_feature 868..873
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (O95832.1);
Region: Interactions with TJP1, TJP2, TJP3 and INADL (By
similarity)"
variation 348
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:72466472"
exon 464..628
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="alignment:Splign:1.39.8"
exon 629..713
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="alignment:Splign:1.39.8"
exon 714..3452
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/inference="alignment:Splign:1.39.8"
variation 978
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3172404"
variation 986
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:3172403"
variation 1137
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1043747"
variation 2086
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:1060679"
variation 2299
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:1060680"
variation 2754
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2204226"
STS 3099..3394
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/standard_name="WI-19957"
/db_xref="UniSTS:78391"
STS 3201..3351
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/standard_name="A001W08"
/db_xref="UniSTS:58726"
STS 3201..3351
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/standard_name="G19705"
/db_xref="UniSTS:58725"
STS 3339..3413
/gene="CLDN1"
/gene_synonym="CLD1; ILVASC; SEMP1"
/standard_name="G30141"
/db_xref="UniSTS:44945"
ORIGIN
gtctcagttcccgagcctgggagcaaccgcagcttctagtatccagactccagcgccgccccgggcgcggaccccaaccccgacccagagcttctccagcggcggcgcagcgagcagggctccccgccttaacttcctccgcggggcccagccaccttcgggagtccgggttgcccacctgcaaactctccgccttctgcacctgccacccctgagccagcgcgggcgcccgagcgagtcatggccaacgcggggctgcagctgttgggcttcattctcgccttcctgggatggatcggcgccatcgtcagcactgccctgccccagtggaggatttactcctatgccggcgacaacatcgtgaccgcccaggccatgtacgaggggctgtggatgtcctgcgtgtcgcagagcaccgggcagatccagtgcaaagtctttgactccttgctgaatctgagcagcacattgcaagcaacccgtgccttgatggtggttggcatcctcctgggagtgatagcaatctttgtggccaccgttggcatgaagtgtatgaagtgcttggaagacgatgaggtgcagaagatgaggatggctgtcattgggggtgcgatatttcttcttgcaggtctggctattttagttgccacagcatggtatggcaatagaatcgttcaagaattctatgaccctatgaccccagtcaatgccaggtacgaatttggtcaggctctcttcactggctgggctgctgcttctctctgccttctgggaggtgccctactttgctgttcctgtccccgaaaaacaacctcttacccaacaccaaggccctatccaaaacctgcaccttccagcgggaaagactacgtgtgacacagaggcaaaaggagaaaatcatgttgaaacaaaccgaaaatggacattgagatactatcattaacattaggaccttagaattttgggtattgtaatctgaagtatggtattacaaaacaaacaaacaaacaaaaaacccatgtgttaaaatactcagtgctaaacatggcttaatcttattttatcttctttcctcaatataggagggaagatttttccatttgtattactgcttcccattgagtaatcatactcaactgggggaaggggtgctccttaaatatatatagatatgtatatatacatgtttttctattaaaaatagacagtaaaatactattctcattatgttgatactagcatacttaaaatatctctaaaataggtaaatgtatttaattccatattgatgaagatgtttattggtatattttctttttcgtctatatatacatatgtaacagtcaaatatcatttactcttcttcattagctttgggtgcctttgccacaagacctagcctaatttaccaaggatgaattctttcaattcttcatgcgtgcccttttcatatacttattttattttttaccataatcttatagcacttgcatcgttattaagcccttatttgttttgtgtttcattggtctctatctcctgaatctaacacatttcatagcctacattttagtttctaaagccaagaagaatttattacaaatcagaactttggaggcaaatctttctgcatgaccaaagtgataaattcctgttgaccttcccacacaatccctgtactctgacccatagcactcttgtttgctttgaaaatatttgtccaattgagtagctgcatgctgttcccccaggtgttgtaacacaactttattgattgaatttttaagctacttattcatagttttatatccccctaaactacctttttgttccccattccttaattgtattgttttcccaagtgtaattatcatgcgttttatatcttcctaataaggtgtggtctgtttgtctgaacaaagtgctagactttctggagtgataatctggtgacaaatattctctctgtagctgtaagcaagtcacttaatctttctacctcttttttctatctgccaaattgagataatgatacttaaccagttagaagaggtagtgtgaatattaattagtttatattactctcattctttgaacatgaactatgcctatgtagtgtctttatttgctcagctggctgagacactgaagaagtcactgaacaaaacctacacacgtaccttcatgtgattcactgccttcctctctctaccagtctatttccactgaacaaaacctacacacataccttcatgtggttcagtgccttcctctctctaccagtctatttccactgaacaaaacctacgcacataccttcatgtggctcagtgccttcctctctctaccagtctatttccattctttcagctgtgtctgacatgtttgtgctctgttccattttaacaactgctcttacttttccagtctgtacagaatgctatttcacttgagcaagatgatgtaatggaaagggtgttggcattggtgtctggagacctggatttgagtcttggtgctatcaatcaccgtctgtgtttgagcaaggcatttggctgctgtaagcttattgcttcatctgtaagcggtggtttgtaattcctgatcttcccacctcacagtgatgttgtggggatccagtgagatagaatacatgtaagtgtggttttgtaatttaaaaagtgctatactaagggaaagaattgaggaattaactgcatacgttttggtgttgcttttcaaatgtttgaaaacaaaaaaaatgttaagaaatgggtttcttgccttaaccagtctctcaagtgatgagacagtgaagtaaaattgagtgcactaaacaaataagattctgaggaagtcttatcttctgcagtgagtatggcccgatgctttctgtggctaaacagatgtaatgggaagaaataaaagcctacgtgttggtaaatccaacagcaagggagatttttgaatcataataactcataaggtgctatctgttcagtgatgccctcagagctcttgctgttagctggcagctgacgctgctaggatagttagtttggaaatggtacttcataataaactacacaaggaaagtcagccactgtgtcttatgaggaattggacctaataaattttagtgtgccttccaaacctgagaatatatgcttttggaagttaaaatttaaatggcttttgccacatacatagatcttcatgatgtgtgagtgtaattccatgtggatatcagttaccaaacattacaaaaaaattttatggcccaaaatgaccaacgaaattgttacaatagaatttatccaattttgatctttttatattcttctaccacacctggaaacagaccaatagacattttggggttttataataggaatttgtataaagcattactctttttcaataaattgttttttaatttaaaaaaaggatta
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:9076 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IEA
GeneID:9076 -> Molecular function: GO:0042802 [identical protein binding] evidence: ISS
GeneID:9076 -> Biological process: GO:0007155 [cell adhesion] evidence: TAS
GeneID:9076 -> Biological process: GO:0016338 [calcium-independent cell-cell adhesion] evidence: ISS
GeneID:9076 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:9076 -> Biological process: GO:0045216 [cell-cell junction organization] evidence: IMP
GeneID:9076 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
GeneID:9076 -> Cellular component: GO:0005923 [tight junction] evidence: ISS
GeneID:9076 -> Cellular component: GO:0016021 [integral to membrane] evidence: TAS
GeneID:9076 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA
GeneID:9076 -> Cellular component: GO:0016328 [lateral plasma membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.