Home |
Help |
Advanced search
2025-05-09 19:08:56, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_020064 1907 bp mRNA linear PRI 18-APR-2013 DEFINITION Homo sapiens BarH-like homeobox 1 (BARHL1), mRNA. ACCESSION NM_020064 VERSION NM_020064.3 GI:187829503 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1907) AUTHORS Poschl,J., Lorenz,A., Hartmann,W., von Bueren,A.O., Kool,M., Li,S., Peraud,A., Tonn,J.C., Herms,J., Xiang,M., Rutkowski,S., Kretzschmar,H.A. and Schuller,U. TITLE Expression of BARHL1 in medulloblastoma is associated with prolonged survival in mice and humans JOURNAL Oncogene 30 (47), 4721-4730 (2011) PUBMED 21602885 REMARK GeneRIF: expression of Barhl1 decelerates tumor growth both in human and in murine medulloblastomas. REFERENCE 2 (bases 1 to 1907) AUTHORS Bulfone,A., Menguzzato,E., Broccoli,V., Marchitiello,A., Gattuso,C., Mariani,M., Consalez,G.G., Martinez,S., Ballabio,A. and Banfi,S. TITLE Barhl1, a gene belonging to a new subfamily of mammalian homeobox genes, is expressed in migrating neurons of the CNS JOURNAL Hum. Mol. Genet. 9 (9), 1443-1452 (2000) PUBMED 10814725 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK054797.1 and AF325688.1. On May 9, 2008 this sequence version replaced gi:31542183. ##Evidence-Data-START## Transcript exon combination :: AK054797.1, AF325688.1 [ECO:0000332] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1789 AK054797.1 1-1789 1790-1857 AF325688.1 1613-1680 1858-1907 AK054797.1 1858-1907 FEATURES Location/Qualifiers source 1..1907 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="9" /map="9q34" gene 1..1907 /gene="BARHL1" /note="BarH-like homeobox 1" /db_xref="GeneID:56751" /db_xref="HGNC:953" /db_xref="HPRD:05554" /db_xref="MIM:605211" exon 1..658 /gene="BARHL1" /inference="alignment:Splign:1.39.8" misc_feature 118..120 /gene="BARHL1" /note="upstream in-frame stop codon" variation 148 /gene="BARHL1" /replace="a" /replace="g" /db_xref="dbSNP:374375190" variation 181 /gene="BARHL1" /replace="c" /replace="t" /db_xref="dbSNP:368046401" variation 192 /gene="BARHL1" /replace="c" /replace="t" /db_xref="dbSNP:371662867" CDS 193..1176 /gene="BARHL1" /codon_start=1 /product="barH-like 1 homeobox protein" /protein_id="NP_064448.1" /db_xref="GI:14149728" /db_xref="CCDS:CCDS6950.1" /db_xref="GeneID:56751" /db_xref="HGNC:953" /db_xref="HPRD:05554" /db_xref="MIM:605211" /translation="
MEGSNGFGIDSILSHRAGSPALPKGDPLLGDCRSPLELSPRSESSSDCSSPASPGRDCLETGTPRPGGASGPGLDSHLQPGQLSAPAQSRTVTSSFLIRDILADCKPLAACAPYSSSGQPAAPEPGGRLAAKAAEDFRDKLDKSGSNASSDSEYKVKEEGDREISSSRDSPPVRLKKPRKARTAFTDHQLAQLERSFERQKYLSVQDRMELAASLNLTDTQVKTWYQNRRTKWKRQTAVGLELLAEAGNYSALQRMFPSPYFYPQSLVSNLDPGAALYLYRGPSAPPPALQRPLVPRILIHGLQGASEPPPPLPPLAGVLPRAAQPR
"
misc_feature 727..900
/gene="BARHL1"
/note="Homeodomain; DNA binding domains involved in the
transcriptional regulation of key eukaryotic developmental
processes; may bind to DNA as monomers or as homo- and/or
heterodimers, in a sequence-specific manner; Region:
homeodomain; cd00086"
/db_xref="CDD:28970"
misc_feature order(727..741,745..747,796..798,814..816,853..855,
859..864,871..876,880..888,892..897)
/gene="BARHL1"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:28970"
misc_feature order(733..735,742..744,862..864,871..876,883..885)
/gene="BARHL1"
/note="specific DNA base contacts [nucleotide binding];
other site"
/db_xref="CDD:28970"
variation 239
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:376566705"
variation 241
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:73659100"
variation 242
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141976331"
variation 271
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:147143563"
variation 295
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140268500"
variation 344
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370488202"
variation 346
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373735108"
variation 348
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376698987"
variation 353
/gene="BARHL1"
/replace="c"
/replace="g"
/db_xref="dbSNP:371086101"
variation 380
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:111444940"
variation 385
/gene="BARHL1"
/replace="a"
/replace="c"
/db_xref="dbSNP:144334349"
variation 404
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147374258"
variation 441
/gene="BARHL1"
/replace="c"
/replace="g"
/db_xref="dbSNP:11243834"
variation 444
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139167917"
variation 447
/gene="BARHL1"
/replace="c"
/replace="g"
/db_xref="dbSNP:145113690"
variation 459
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374889537"
variation 471
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200079573"
variation 516
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:35351645"
variation 530
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:368144490"
variation 534
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201325944"
variation 584
/gene="BARHL1"
/replace="a"
/replace="c"
/db_xref="dbSNP:149116109"
exon 659..881
/gene="BARHL1"
/inference="alignment:Splign:1.39.8"
variation 674
/gene="BARHL1"
/replace="a"
/replace="t"
/db_xref="dbSNP:371655690"
variation 684
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201129187"
variation 713
/gene="BARHL1"
/replace="c"
/replace="g"
/db_xref="dbSNP:55836017"
variation 732
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143453765"
variation 765
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146556792"
variation 804
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:368358949"
variation 814
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141204847"
variation 828
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:115324433"
exon 882..1907
/gene="BARHL1"
/inference="alignment:Splign:1.39.8"
variation 909
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:111570450"
variation 921
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200018434"
variation 1002
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201426274"
variation 1059
/gene="BARHL1"
/replace="a"
/replace="t"
/db_xref="dbSNP:200567501"
variation 1082
/gene="BARHL1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377171961"
variation 1339
/gene="BARHL1"
/replace="a"
/replace="c"
/db_xref="dbSNP:183364605"
variation 1517
/gene="BARHL1"
/replace="g"
/replace="t"
/db_xref="dbSNP:394916"
variation 1790
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:381977"
variation 1806
/gene="BARHL1"
/replace="c"
/replace="t"
/db_xref="dbSNP:58476421"
ORIGIN
cttttggatctaatgcgcagaggaggttggcccagagctcccgggctcccccaaggctgaactccgtccaaggtgcccgcaggctccctgcccgccttccccatgccagcccgcagctaggggcaggggcagcggcggctggggttgggggtgggtggggagcttttggggaggacaggtcgcagcttggctatggaaggctccaatggctttgggatcgactccattctctcccaccgcgcgggcagccccgcccttcccaagggggaccccttgctcggggactgccgttcgcccctggagctgagtccacgctcagagagcagcagcgactgctcttcgccagcctctccaggaagggactgtttggagacggggaccccacggcctggcggggcatccggcccaggtttggactcccacctgcagcccgggcagctctcagccccggcccagtcgcgcaccgtcacctcctcctttctgatcagggacatccttgccgactgcaaaccactcgcggcctgtgcaccctactctagcagcgggcagccggcagcccctgagcctgggggccgccttgcggccaaggccgcggaggactttagagacaagctggacaaaagtggcagcaacgcctcatcggactctgagtataaagtgaaggaggagggcgaccgcgagatctccagctccagggacagtcccccggtgcgcctgaaaaagccacgcaaggcgcgcacggccttcaccgaccatcagctggcgcagctggagcgcagcttcgagcggcagaagtacctgagcgtgcaggaccgcatggagctcgccgcctcgctcaacctcaccgacacgcaggtcaagacctggtaccagaaccgcaggactaaatggaagcgacagacggccgtcgggttggagctgctggcggaggcaggcaattactcagcgctccagcggatgttcccgtcgccttatttctacccgcagagtctggtttccaacctggaccccggcgcggcgctctacctgtaccgcggccccagcgcgccgccgcctgctctccagagacctctggtgccccgcatcctcatccacggactccagggcgccagcgagccgcccccgccgctgccccccctggccggcgtcctcccacgcgccgcgcagcctcggtgaggcgcccgtcggctccggggcctcctcccgcgggctcggcgtggccccttccgcccgcctttctgagggcgcaggttcgacgccctttcccgggagggggccctgcccggccctccctggcgccccagcccagtgccccccgaagggccaaatgccaagtccactgaggcccggaccccggactgcgtctccccagcccccctcggcgtcctctctcgcggccgctctgtccgggagccatccccacccgccgggtgtacatacgcgtctctgccactccccacccccagcctctgccggctcccctaggcaacccctttctccccaggagcgggtgcggctgattcccaggcttcgctctctcccacgccccttctacgctccaggtggagaacagcccctctccccgcgcccccgccagggagagaaggggagtgcggagccccgtctccctacccctcgagcacctgggccagcggctgagctgtacataccgtgtgcaaagtgtatatgaagttatttattcgtgacccatgagcccgtgaccgtgtccgtggattagtgagtctgtggcctgtgccctccccactcccaggcggggcaggaaggggccaagggggcttgcccacccaccccgaccccagcccccagcctcagccccggtccgggggcagccaggcctctcgggttctctcttttttaaatgtcgaaataaacttcttacaaatgac
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:56751 -> Molecular function: GO:0001077 [RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription] evidence: IEA
GeneID:56751 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:56751 -> Biological process: GO:0001764 [neuron migration] evidence: IEA
GeneID:56751 -> Biological process: GO:0007605 [sensory perception of sound] evidence: IEA
GeneID:56751 -> Biological process: GO:0030901 [midbrain development] evidence: IEA
GeneID:56751 -> Biological process: GO:0043524 [negative regulation of neuron apoptotic process] evidence: IEA
GeneID:56751 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.