GGRNA Home | Help | Advanced search

2025-06-07 10:33:46, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018942               1896 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens H6 family homeobox 1 (HMX1), mRNA.
ACCESSION   NM_018942 XM_001133154
VERSION     NM_018942.2  GI:116805349
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1896)
  AUTHORS   Vaclavik,V., Schorderet,D.F., Borruat,F.X. and Munier,F.L.
  TITLE     Retinal dystrophy in the oculo-auricular syndrome due to HMX1
            mutation
  JOURNAL   Ophthalmic Genet. 32 (2), 114-117 (2011)
   PUBMED   21417677
  REMARK    GeneRIF: The retinal degeneration in the recessively inherited
            oculo-auricular syndrome is a progressive rod-cone dystrophy.
REFERENCE   2  (bases 1 to 1896)
  AUTHORS   Schorderet,D.F., Nichini,O., Boisset,G., Polok,B., Tiab,L.,
            Mayeur,H., Raji,B., de la Houssaye,G., Abitbol,M.M. and Munier,F.L.
  TITLE     Mutation in the human homeobox gene NKX5-3 causes an
            oculo-auricular syndrome
  JOURNAL   Am. J. Hum. Genet. 82 (5), 1178-1184 (2008)
   PUBMED   18423520
  REMARK    GeneRIF: Linkage analysis and mutation screening revealed in the
            first exon of the NKX5-3 gene a homozygous 26 nucleotide deletion,
            generating a truncating protein that lacked the complete
            homeodomain.
REFERENCE   3  (bases 1 to 1896)
  AUTHORS   Amendt,B.A., Sutherland,L.B. and Russo,A.F.
  TITLE     Transcriptional antagonism between Hmx1 and Nkx2.5 for a shared
            DNA-binding site
  JOURNAL   J. Biol. Chem. 274 (17), 11635-11642 (1999)
   PUBMED   10206974
REFERENCE   4  (bases 1 to 1896)
  AUTHORS   Stadler,H.S., Murray,J.C., Leysens,N.J., Goodfellow,P.J. and
            Solursh,M.
  TITLE     Phylogenetic conservation and physical mapping of members of the H6
            homeobox gene family
  JOURNAL   Mamm. Genome 6 (6), 383-388 (1995)
   PUBMED   7647458
REFERENCE   5  (bases 1 to 1896)
  AUTHORS   Stadler,H.S., Padanilam,B.J., Buetow,K., Murray,J.C. and Solursh,M.
  TITLE     Identification and genetic mapping of a homeobox gene to the 4p16.1
            region of human chromosome 4
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 89 (23), 11579-11583 (1992)
   PUBMED   1360670
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC116612.5.
            This sequence is a reference standard in the RefSeqGene project.
            On Oct 27, 2006 this sequence version replaced gi:9506784.
            
            Summary: This gene encodes a transcription factor that belongs to
            the H6 family of homeobox proteins. This protein can bind a
            5'-CAAG-3' core DNA sequence, and it is involved in the development
            of craniofacial structures. Mutations in this gene cause
            oculoauricular syndrome, a disorder of the eye and external ear.
            [provided by RefSeq, Oct 2009].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M99587.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-597               AC116612.5         43579-44175         c
            598-1896            AC116612.5         39405-40703         c
FEATURES             Location/Qualifiers
     source          1..1896
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p16.1"
     gene            1..1896
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /note="H6 family homeobox 1"
                     /db_xref="GeneID:3166"
                     /db_xref="HGNC:5017"
                     /db_xref="MIM:142992"
     exon            1..597
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /inference="alignment:Splign:1.39.8"
     variation       74
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4074894"
     variation       94
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4074895"
     CDS             204..1250
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /note="H6 homeodomain protein; homeobox protein H6"
                     /codon_start=1
                     /product="homeobox protein HMX1"
                     /protein_id="NP_061815.2"
                     /db_xref="GI:116805350"
                     /db_xref="CCDS:CCDS47018.1"
                     /db_xref="GeneID:3166"
                     /db_xref="HGNC:5017"
                     /db_xref="MIM:142992"
                     /translation="
MPDELTEPGRATPARASSFLIENLLAAEAKGAGRATQGDGSREDEEEDDDDPEDEDAEQARRRRLQRRRQLLAGTGPGGEARARALLGPGALGLGPRPPPGPGPPFALGCGGAARWYPRAHGGYGGGLSPDTSDRDSPETGEEMGRAEGAWPRGPGPGAVQREAAELAARGPAAGTEEASELAEVPAAAGETRGGVGVGGGRKKKTRTVFSRSQVFQLESTFDLKRYLSSAERAGLAASLQLTETQVKIWFQNRRNKWKRQLAAELEAASLSPPGAQRLVRVPVLYHESPPAAAAAGPPATLPFPLAPAAPAPPPPLLGFSGALAYPLAAFPAAASVPFLRAQMPGLV
"
     misc_feature    831..986
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(831..833,882..884,900..902,939..941,945..950,
                     957..962,966..974,978..983)
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(948..950,957..962,969..971)
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    990..1022
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NP08.2);
                     Region: HMX family specific domain 1"
     misc_feature    1029..1070
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9NP08.2);
                     Region: HMX family specific domain 2"
     variation       418..443
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /replace=""
                     /replace="tcgcgggcaccgggcccggcggggag"
                     /db_xref="dbSNP:63751898"
     exon            598..1896
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    1873..1878
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
     polyA_site      1896
                     /gene="HMX1"
                     /gene_synonym="H6; NKX5-3"
ORIGIN      
ccgatcagctgtcggcgcgcactcgctcccggcccggcccagcccagcccggcgcggaggccgccgcctgccctgcggggcccgacgccagcggtccgggtagcagctccagggccggcccgcgcgtgcgcccgggagccgcgcgccaccatccccagcggggaccgaggagcccggccgagcccgagaagcccgcggccgcgatgcctgacgagctgacggagcccgggcgcgccacgccggcccgcgcctcctccttcctcatcgagaacctgctggcggccgaggccaagggcgcagggcgcgcgacccagggcgacggcagccgggaggacgaggaggaggacgacgacgaccccgaagacgaggacgccgagcaggcgcggcggcgacggctacagcggcggcgacagttgctcgcgggcaccgggcccggcggggaggcgcgggcccgtgcgctgctcgggccgggcgcgctgggcctcggtcctcggccgccccccggtcccgggccgcccttcgctctgggctgcggaggcgcagcgcgctggtacccacgggcgcacggtggctatggaggcggcctcagtcctgacaccagcgaccgggactcaccggagacgggcgaggagatgggccgtgcggagggcgcctggccgcgaggccccgggccgggagcggtgcagcgggaggcagcggagctggcggcgcgtggcccggcggccggcacggaggaggcgtcggagctggccgaggtccctgcggcggctggggagacacgcggcggcgttggcgtgggcggcggccgaaagaagaagacgcgcacagtcttctcccgcagccaggtcttccagctggaatccaccttcgacctgaagcgctacctgagcagcgccgagcgcgccggcctggccgcctccctgcagctcaccgagacgcaggttaagatctggttccagaaccgccgcaacaagtggaagcggcagctggcagccgagctggaggcggccagcctgtccccgccgggagcgcagcgcctggtccgcgtgccggtgctctaccacgaaagccccccggccgcagccgccgctgggcccccggccaccctgcccttcccgctggcgcccgccgcgcccgcgccgcccccaccgctgctcggcttctccggggccctcgcctacccgctggccgccttcccggccgccgcctccgtgccctttctgcgggcgcagatgcctggcctggtgtgagccccgcctgccgggccctctccccacgaccctgtggacctgtgtggacgcgcgattcagcggcaggcgcagggctcagggggcgttagggaagggatggtcgctcctgcggcctcctagatacctcgggagcgcaggccgcggccgggcgggcctcagcttctgtggggagcgcctctagaatgtaatgggacgccccacccatttgccaggctggatccccactcgaacagggggccatgcagagactctgggctgcgcagcccccggcgccacggccaccccccggcctcagcgaggagcggtcggccatggccacccggggcagctgccctcaggccaagcccagcgcaacaaaggaaaactacgaaccggctgtccaaggctgagcggtgactgtccccacagactgcccccaacactaaacgtccctttcctgggacccagacagcaggccggcccggagggctgtgctacccctctcgcgggtgctggtggagaaaggaccctggacctgtgggtcccatcgtccgttccaggagcaggcaggctggggctctctgcagacgtcgcagcctccgggttgttgtttttttaaatgaatctacttatttgcgtatggaataaaaagggacattttctggac
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3166 -> Molecular function: GO:0003677 [DNA binding] evidence: IMP
            GeneID:3166 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:3166 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:3166 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:3166 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:3166 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
            GeneID:3166 -> Cellular component: GO:0005634 [nucleus] evidence: IC

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.