2025-06-07 10:33:46, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018942 1896 bp mRNA linear PRI 18-APR-2013 DEFINITION Homo sapiens H6 family homeobox 1 (HMX1), mRNA. ACCESSION NM_018942 XM_001133154 VERSION NM_018942.2 GI:116805349 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1896) AUTHORS Vaclavik,V., Schorderet,D.F., Borruat,F.X. and Munier,F.L. TITLE Retinal dystrophy in the oculo-auricular syndrome due to HMX1 mutation JOURNAL Ophthalmic Genet. 32 (2), 114-117 (2011) PUBMED 21417677 REMARK GeneRIF: The retinal degeneration in the recessively inherited oculo-auricular syndrome is a progressive rod-cone dystrophy. REFERENCE 2 (bases 1 to 1896) AUTHORS Schorderet,D.F., Nichini,O., Boisset,G., Polok,B., Tiab,L., Mayeur,H., Raji,B., de la Houssaye,G., Abitbol,M.M. and Munier,F.L. TITLE Mutation in the human homeobox gene NKX5-3 causes an oculo-auricular syndrome JOURNAL Am. J. Hum. Genet. 82 (5), 1178-1184 (2008) PUBMED 18423520 REMARK GeneRIF: Linkage analysis and mutation screening revealed in the first exon of the NKX5-3 gene a homozygous 26 nucleotide deletion, generating a truncating protein that lacked the complete homeodomain. REFERENCE 3 (bases 1 to 1896) AUTHORS Amendt,B.A., Sutherland,L.B. and Russo,A.F. TITLE Transcriptional antagonism between Hmx1 and Nkx2.5 for a shared DNA-binding site JOURNAL J. Biol. Chem. 274 (17), 11635-11642 (1999) PUBMED 10206974 REFERENCE 4 (bases 1 to 1896) AUTHORS Stadler,H.S., Murray,J.C., Leysens,N.J., Goodfellow,P.J. and Solursh,M. TITLE Phylogenetic conservation and physical mapping of members of the H6 homeobox gene family JOURNAL Mamm. Genome 6 (6), 383-388 (1995) PUBMED 7647458 REFERENCE 5 (bases 1 to 1896) AUTHORS Stadler,H.S., Padanilam,B.J., Buetow,K., Murray,J.C. and Solursh,M. TITLE Identification and genetic mapping of a homeobox gene to the 4p16.1 region of human chromosome 4 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 89 (23), 11579-11583 (1992) PUBMED 1360670 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC116612.5. This sequence is a reference standard in the RefSeqGene project. On Oct 27, 2006 this sequence version replaced gi:9506784. Summary: This gene encodes a transcription factor that belongs to the H6 family of homeobox proteins. This protein can bind a 5'-CAAG-3' core DNA sequence, and it is involved in the development of craniofacial structures. Mutations in this gene cause oculoauricular syndrome, a disorder of the eye and external ear. [provided by RefSeq, Oct 2009]. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: M99587.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-597 AC116612.5 43579-44175 c 598-1896 AC116612.5 39405-40703 c FEATURES Location/Qualifiers source 1..1896 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="4" /map="4p16.1" gene 1..1896 /gene="HMX1" /gene_synonym="H6; NKX5-3" /note="H6 family homeobox 1" /db_xref="GeneID:3166" /db_xref="HGNC:5017" /db_xref="MIM:142992" exon 1..597 /gene="HMX1" /gene_synonym="H6; NKX5-3" /inference="alignment:Splign:1.39.8" variation 74 /gene="HMX1" /gene_synonym="H6; NKX5-3" /replace="g" /replace="t" /db_xref="dbSNP:4074894" variation 94 /gene="HMX1" /gene_synonym="H6; NKX5-3" /replace="c" /replace="g" /db_xref="dbSNP:4074895" CDS 204..1250 /gene="HMX1" /gene_synonym="H6; NKX5-3" /note="H6 homeodomain protein; homeobox protein H6" /codon_start=1 /product="homeobox protein HMX1" /protein_id="NP_061815.2" /db_xref="GI:116805350" /db_xref="CCDS:CCDS47018.1" /db_xref="GeneID:3166" /db_xref="HGNC:5017" /db_xref="MIM:142992" /translation="
MPDELTEPGRATPARASSFLIENLLAAEAKGAGRATQGDGSREDEEEDDDDPEDEDAEQARRRRLQRRRQLLAGTGPGGEARARALLGPGALGLGPRPPPGPGPPFALGCGGAARWYPRAHGGYGGGLSPDTSDRDSPETGEEMGRAEGAWPRGPGPGAVQREAAELAARGPAAGTEEASELAEVPAAAGETRGGVGVGGGRKKKTRTVFSRSQVFQLESTFDLKRYLSSAERAGLAASLQLTETQVKIWFQNRRNKWKRQLAAELEAASLSPPGAQRLVRVPVLYHESPPAAAAAGPPATLPFPLAPAAPAPPPPLLGFSGALAYPLAAFPAAASVPFLRAQMPGLV
" misc_feature 831..986 /gene="HMX1" /gene_synonym="H6; NKX5-3" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(831..833,882..884,900..902,939..941,945..950, 957..962,966..974,978..983) /gene="HMX1" /gene_synonym="H6; NKX5-3" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(948..950,957..962,969..971) /gene="HMX1" /gene_synonym="H6; NKX5-3" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 990..1022 /gene="HMX1" /gene_synonym="H6; NKX5-3" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NP08.2); Region: HMX family specific domain 1" misc_feature 1029..1070 /gene="HMX1" /gene_synonym="H6; NKX5-3" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9NP08.2); Region: HMX family specific domain 2" variation 418..443 /gene="HMX1" /gene_synonym="H6; NKX5-3" /replace="" /replace="tcgcgggcaccgggcccggcggggag" /db_xref="dbSNP:63751898" exon 598..1896 /gene="HMX1" /gene_synonym="H6; NKX5-3" /inference="alignment:Splign:1.39.8" polyA_signal 1873..1878 /gene="HMX1" /gene_synonym="H6; NKX5-3" polyA_site 1896 /gene="HMX1" /gene_synonym="H6; NKX5-3" ORIGIN
ccgatcagctgtcggcgcgcactcgctcccggcccggcccagcccagcccggcgcggaggccgccgcctgccctgcggggcccgacgccagcggtccgggtagcagctccagggccggcccgcgcgtgcgcccgggagccgcgcgccaccatccccagcggggaccgaggagcccggccgagcccgagaagcccgcggccgcgatgcctgacgagctgacggagcccgggcgcgccacgccggcccgcgcctcctccttcctcatcgagaacctgctggcggccgaggccaagggcgcagggcgcgcgacccagggcgacggcagccgggaggacgaggaggaggacgacgacgaccccgaagacgaggacgccgagcaggcgcggcggcgacggctacagcggcggcgacagttgctcgcgggcaccgggcccggcggggaggcgcgggcccgtgcgctgctcgggccgggcgcgctgggcctcggtcctcggccgccccccggtcccgggccgcccttcgctctgggctgcggaggcgcagcgcgctggtacccacgggcgcacggtggctatggaggcggcctcagtcctgacaccagcgaccgggactcaccggagacgggcgaggagatgggccgtgcggagggcgcctggccgcgaggccccgggccgggagcggtgcagcgggaggcagcggagctggcggcgcgtggcccggcggccggcacggaggaggcgtcggagctggccgaggtccctgcggcggctggggagacacgcggcggcgttggcgtgggcggcggccgaaagaagaagacgcgcacagtcttctcccgcagccaggtcttccagctggaatccaccttcgacctgaagcgctacctgagcagcgccgagcgcgccggcctggccgcctccctgcagctcaccgagacgcaggttaagatctggttccagaaccgccgcaacaagtggaagcggcagctggcagccgagctggaggcggccagcctgtccccgccgggagcgcagcgcctggtccgcgtgccggtgctctaccacgaaagccccccggccgcagccgccgctgggcccccggccaccctgcccttcccgctggcgcccgccgcgcccgcgccgcccccaccgctgctcggcttctccggggccctcgcctacccgctggccgccttcccggccgccgcctccgtgccctttctgcgggcgcagatgcctggcctggtgtgagccccgcctgccgggccctctccccacgaccctgtggacctgtgtggacgcgcgattcagcggcaggcgcagggctcagggggcgttagggaagggatggtcgctcctgcggcctcctagatacctcgggagcgcaggccgcggccgggcgggcctcagcttctgtggggagcgcctctagaatgtaatgggacgccccacccatttgccaggctggatccccactcgaacagggggccatgcagagactctgggctgcgcagcccccggcgccacggccaccccccggcctcagcgaggagcggtcggccatggccacccggggcagctgccctcaggccaagcccagcgcaacaaaggaaaactacgaaccggctgtccaaggctgagcggtgactgtccccacagactgcccccaacactaaacgtccctttcctgggacccagacagcaggccggcccggagggctgtgctacccctctcgcgggtgctggtggagaaaggaccctggacctgtgggtcccatcgtccgttccaggagcaggcaggctggggctctctgcagacgtcgcagcctccgggttgttgtttttttaaatgaatctacttatttgcgtatggaataaaaagggacattttctggac
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:3166 -> Molecular function: GO:0003677 [DNA binding] evidence: IMP GeneID:3166 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:3166 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:3166 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:3166 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA GeneID:3166 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP GeneID:3166 -> Cellular component: GO:0005634 [nucleus] evidence: IC
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.