GGRNA Home | Help | Advanced search

2025-05-09 19:11:22, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_018186               3363 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens chromosome 1 open reading frame 112 (C1orf112), mRNA.
ACCESSION   NM_018186
VERSION     NM_018186.2  GI:40254930
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3363)
  AUTHORS   van Dam,S., Cordeiro,R., Craig,T., van Dam,J., Wood,S.H. and de
            Magalhaes,J.P.
  TITLE     GeneFriends: an online co-expression analysis tool to identify
            novel gene targets for aging and complex diseases
  JOURNAL   BMC Genomics 13, 535 (2012)
   PUBMED   23039964
  REMARK    GeneRIF: Knockdown of C1orf112 by siRNA in HeLa cells significantly
            suppressed their growth.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3363)
  AUTHORS   Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
  TITLE     Follow-up of a major linkage peak on chromosome 1 reveals
            suggestive QTLs associated with essential hypertension: GenNet
            study
  JOURNAL   Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
   PUBMED   19536175
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 3363)
  AUTHORS   Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
            Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
  TITLE     Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
            genetic association with bone mineral density variation
  JOURNAL   Hum. Mol. Genet. 18 (4), 679-687 (2009)
   PUBMED   19064610
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
COMMENT     PREDICTED REFSEQ: This record has not been reviewed and the
            function is unknown. The reference sequence was derived from
            AL354614.1.
            On Dec 20, 2003 this sequence version replaced gi:8922604.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AL354614.1, BC107169.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..3363
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q24.2"
     gene            1..3363
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="chromosome 1 open reading frame 112"
                     /db_xref="GeneID:55732"
                     /db_xref="HGNC:25565"
                     /db_xref="HPRD:07694"
     exon            1..575
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    1..493
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AI636820 from clone IMAGE:2232951;
                     matches EST AI143214 from clone IMAGE:1705654"
     misc_feature    1..489
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA045249 from clone IMAGE:376624"
     misc_feature    1..419
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA505146 from clone IMAGE:825821"
     misc_feature    1..374
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA978262 from clone IMAGE:1579851"
     misc_feature    1..352
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST R42858 from clone IMAGE:31462"
     misc_feature    1..314
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA844031 from clone IMAGE:1388232"
     misc_feature    1..299
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AI221282 from clone IMAGE:1842585"
     misc_feature    1..229
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA256694 from clone IMAGE:682325"
     misc_feature    1..199
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AI625350 from clone IMAGE:2230748"
     misc_feature    2..272
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA535882 from clone IMAGE:927171"
     misc_feature    4..521
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AI677860 from clone IMAGE:2330028"
     variation       19
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3766132"
     variation       40
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115359649"
     variation       77
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144721759"
     variation       87..88
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:148426326"
     variation       317
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368204885"
     variation       339
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77972416"
     variation       346
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182053931"
     variation       375..378
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="ttct"
                     /db_xref="dbSNP:199527192"
     variation       377..380
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="cttt"
                     /db_xref="dbSNP:376222023"
     variation       442
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113859366"
     variation       443
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72514418"
     variation       443
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74231893"
     variation       444..445
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:33911820"
     variation       467
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:16862695"
     variation       503
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:10919246"
     exon            576..677
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       611
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6680938"
     misc_feature    626..628
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="upstream in-frame stop codon"
     variation       658
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6668114"
     exon            678..766
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     CDS             701..3262
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /codon_start=1
                     /product="uncharacterized protein C1orf112"
                     /protein_id="NP_060656.2"
                     /db_xref="GI:40254931"
                     /db_xref="CCDS:CCDS1285.1"
                     /db_xref="GeneID:55732"
                     /db_xref="HGNC:25565"
                     /db_xref="HPRD:07694"
                     /translation="
MFLPHMNHLTLEQTFFSQVLPKTVKLFDDMMYELTSQARGLSSQNLEIQTTLRNILQTMVQLLGALTGCVQHICATQESIILENIQSLPSSVLHIIKSTFVHCKNSESVYSGCLHLVSDLLQALFKEAYSLQKQLMELLDMVCMDPLVDDNDDILNMVIVIHSLLDICSVISSMDHAFHANTWKFIIKQSLKHQSIIKSQLKHKDIITSLCEDILFSFHSCLQLAEQMTQSDAQDNADYRLFQKTLKLCRFFANSLLHYAKEFLPFLSDSCCTLHQLYLQIHSKFPPSLYATRISKAHQEEIAGAFLVTLDPLISQLLTFQPFMQVVLDSKLDLPCELQFPQCLLLVVVMDKLPSQPKEVQTLWCTDSQVSETTTRISLLKAVFYSFEQCSGELSLPVHLQGLKSKGKAEVAVTLYQHVCVHLCTFITSFHPSLFAELDAALLNAVLSANMITSLLAMDAWCFLARYGTAELCAHHVTIVAHLIKSCPGECYQLINLSILLKRLFFFMAPPHQLEFIQKFSPKEAENLPLWQHISFQALPPELREQTVHEVTTVGTAECRKWLSRSRTLGELESLNTVLSALLAVCNSAGEALDTGKQTAIIEVVSQLWAFLNIKQVADQPYVQQTFSLLLPLLGFFIQTLDPKLILQAVTLQTSLLKLELPDYVRLAMLDFVSSLGKLFIPEAIQDRILPNLSCMFALLLADRSWLLEQHTLEAFTQFAEGTNHEEIVPQCLSSEETKNKVVSFLEKTGFVDETEAAKVERVKQEKGIFWEPFANVTVEEAKRSSLQPYAKRARQEFPWEEEYRSALHTIAGALEATESLLQKGPAPAWLSMEMEALQERMDKLKRYIHTLG
"
     misc_feature    3074..3076
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (Q9NSG2.1); acetylation site"
     variation       713
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150100828"
     exon            767..871
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       823
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375959152"
     variation       838
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368991312"
     exon            872..1012
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       900
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138640089"
     variation       901
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201977022"
     variation       928
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146229767"
     variation       932
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373199422"
     variation       935
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376177124"
     variation       952
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186128009"
     variation       959
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144274713"
     variation       961
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148755847"
     variation       964
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151250010"
     variation       978
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200555038"
     variation       996
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180687535"
     exon            1013..1178
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1018
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201023910"
     variation       1023
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201886828"
     variation       1027
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147711417"
     variation       1041
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370208533"
     variation       1114
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11590604"
     variation       1128
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144946376"
     variation       1131
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374141112"
     variation       1134
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199744208"
     variation       1148
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143006454"
     variation       1171
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367824430"
     exon            1179..1263
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1182
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145543630"
     variation       1225
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192980177"
     variation       1242
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144983355"
     exon            1264..1402
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1313
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371455881"
     variation       1325
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74953085"
     variation       1330
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200466685"
     variation       1365
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139732947"
     variation       1395
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113981899"
     exon            1403..1483
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1407
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375877474"
     variation       1477
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112569201"
     exon            1484..1548
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1499
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372665901"
     variation       1517
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144662128"
     variation       1534
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200701654"
     exon            1549..1697
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1554
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142988055"
     variation       1635
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377480387"
     variation       1644
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371775846"
     variation       1655
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:5019203"
     exon            1698..1827
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1705
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149832132"
     variation       1726
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201673352"
     variation       1733
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373868174"
     variation       1756
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141070074"
     variation       1777
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147902019"
     variation       1800
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151303105"
     variation       1807
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149698707"
     variation       1810
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199711855"
     variation       1818
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368806580"
     exon            1828..2014
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1847
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199972566"
     variation       1852
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370645133"
     variation       1868
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140223103"
     variation       1901
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202166855"
     variation       1937
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373215763"
     variation       1952
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377308166"
     exon            2015..2097
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    2055..2281
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA372264"
     variation       2072
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375726175"
     exon            2098..2149
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2134
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369383155"
     variation       2135
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202022925"
     variation       2141
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2272920"
     variation       2144
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373319656"
     exon            2150..2239
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2186
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201956753"
     variation       2206
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373018255"
     variation       2207
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376471585"
     variation       2231
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199924835"
     exon            2240..2425
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2284
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370624050"
     variation       2286
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374739512"
     variation       2314
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372445850"
     variation       2319
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375547099"
     variation       2392
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368600637"
     variation       2399
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141448631"
     variation       2400
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138421783"
     exon            2426..2548
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2432
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376679451"
     variation       2442
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369137831"
     variation       2465
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111505483"
     variation       2488
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147256909"
     variation       2493
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202036615"
     variation       2498
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149853039"
     variation       2502
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199686999"
     variation       2514
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375124353"
     misc_feature    2517..3021
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA045214 from clone IMAGE:376624"
     exon            2549..2644
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2553
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185940964"
     variation       2562
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144964944"
     variation       2566
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376331059"
     variation       2599
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373692979"
     variation       2608
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371749853"
     variation       2630
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370430649"
     misc_feature    2634..3091
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA491378 from clone IMAGE:825821"
     exon            2645..2758
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2684
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372502659"
     misc_feature    2694..2760
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST W20092 from clone IMAGE:305970"
     variation       2697
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146693956"
     variation       2752
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143961599"
     variation       2757
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181455874"
     exon            2759..2863
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2772
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141083239"
     misc_feature    2781..3198
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AA255801 from clone IMAGE:682325"
     variation       2798
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199894284"
     variation       2845
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138665936"
     variation       2849
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368545217"
     variation       2857
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143577187"
     exon            2864..2944
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2873
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200039690"
     variation       2883
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372992913"
     variation       2884
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143920166"
     exon            2945..3064
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2949
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74523449"
     variation       2985
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139434399"
     variation       2986
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116769474"
     variation       2993
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373731734"
     variation       3034
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377477768"
     variation       3042
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149928320"
     variation       3048
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374190475"
     exon            3065..3363
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /inference="alignment:Splign:1.39.8"
     variation       3065
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200810095"
     variation       3083
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371038958"
     variation       3120
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374472770"
     variation       3121
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374957147"
     misc_feature    3138..3281
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /note="matches EST AI630082 from clone ad01d11"
     variation       3181
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370575837"
     STS             3208..3313
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /standard_name="SHGC-75871"
                     /db_xref="UniSTS:16040"
     variation       3211
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191037390"
     variation       3222
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:41308405"
     variation       3223
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367920603"
     variation       3269
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372516539"
     variation       3274..3275
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="ggcagaact"
                     /db_xref="dbSNP:112674836"
     variation       3274
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76988021"
     variation       3276..3277
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace=""
                     /replace="cagaactgg"
                     /replace="gcagaactg"
                     /db_xref="dbSNP:71840872"
     variation       3286
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199793803"
     variation       3287
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200209646"
     variation       3361
                     /gene="C1orf112"
                     /gene_synonym="RP1-97P20.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3180650"
ORIGIN      
ggctttggccctggaaagcctcgcggacgtgttctgacccaaggttttagcagtggatgtggcgttttcttccattccttctttcagtttttctgtactcgttgcttgcaattaagtgtaaatacttttgctagtggataatgggggaggcaaggactgagacctgcggtatgacgatagctctggctcttaatagtttgaggtaaagcgagatactctgagcttttgtctcccgtaaaaagggtggtgaatatgaataagggctttcttagcgttataagaattaaagggcatagttctgtggtgtgaaatctttaaaagatgttcagtaaataaaaatgattttcctccttcccctctcagacctctttttcttctttctttctttttttttgacaagttctcactcctctcacccaggctggagtctttctgaaagagttcttccgcttgttgttggctttcaactgttggatttgaggcgcttagcgccttcttcgtccgggtgcagcacattcttgattggtctcatgcctttgtggttgtaaatgtgcctggaatcctagcctttcatggtttgttctgagtaatgaataccctattactatgatactagtatcttccttaattatcctactcattgtctcaacattctgacagttggattgagcatattcaaattttgaaaattattgtagaaatgtttttacctcatatgaaccacctgacattggaacagactttcttttcacaagtgttaccaaagactgtgaaattattcgatgacatgatgtatgaattaaccagtcaagccagaggactgtcaagccaaaatttggaaatccagaccactctaaggaatattttacaaacaatggtgcagctcttaggagctctcacaggatgtgttcagcatatctgtgccacacaggaatccatcattttggaaaatattcagagtctcccctcctcagtccttcatataattaaaagcacatttgtgcattgtaagaatagtgaatctgtgtattctgggtgtttacacctagtttcagaccttctccaggctcttttcaaggaggcctattctcttcaaaagcagttaatggaactgctggacatggtttgcatggaccctttagtagatgacaatgatgatattttgaatatggtaatagttattcattctttattggatatctgctctgttatttccagtatggaccatgcatttcatgccaatacttggaagtttataattaagcagagccttaagcaccagtccataataaaaagccagttgaaacacaaagatataattactagcttgtgtgaagacattcttttctccttccattcttgtttacagttagctgagcagatgacacagtcagatgcacaggataatgctgactacagattatttcagaaaacactcaaattgtgtcgtttttttgccaactcccttttgcactacgctaaggaatttcttcctttcctctctgattcttgctgtactttgcaccaactgtatcttcagatacacagcaagtttcctccaagcctttatgctaccaggatttctaaagcacaccaagaggaaatagcaggtgctttcctagtgacactggatccacttatcagtcagctgctcacatttcagcctttcatgcaggtggttttggacagtaaattagacctgccatgtgaactgcagtttccacaatgtcttcttctggttgttgtcatggataagctgccatctcagcctaaggaagtgcaaaccctgtggtgcacagacagccaggtctcagaaacgacaaccaggatatctctactcaaagccgttttctacagttttgagcagtgttctggtgaactctctctacctgttcatttacagggattaaagagtaaggggaaagctgaggtggctgtcaccttgtatcagcatgtttgtgttcatctgtgtacatttattacttcctttcatccctcactgtttgctgaactggatgctgctctgctgaatgctgtacttagtgctaatatgatcacctctttgttagctatggatgcatggtgcttccttgctcgatatgggactgctgaactgtgtgcacaccatgtcaccatagtggctcatctgataaagtcatgccctggagaatgttatcaactcatcaacctatcaatactgttgaagcgtctctttttcttcatggcaccaccccatcagctggagtttatccagaaattttccccaaaagaagcagaaaatctgcctctgtggcaacatatttccttccaggcgttacctcctgagcttagggaacaaactgtccatgaggtcaccacagtaggcactgcagaatgcaggaaatggctgagcaggagtcgtactttgggagaactagaatctctgaacacagtactgtctgctttgcttgcagtatgtaattctgctggtgaagctttggatacaggaaaacaaactgcaattatcgaagttgtgagtcagctttgggcttttttaaacattaaacaggtagcagatcaaccttatgttcaacagacattcagccttttacttccactgttgggatttttcattcaaactctagatcctaaactgatacttcaggcagtaactttgcagacctcgctacttaaattagagcttcctgactatgttcgtttggcaatgttggattttgtatcttctttaggaaaactttttatacctgaagctatccaggacagaattctgcccaacctgtcctgtatgtttgccttactgctagctgacaggagttggctgctagaacaacataccttggaggcgtttactcagttcgctgagggaacaaatcatgaagagatagttccacagtgtctcagttctgaagaaactaagaacaaagttgtatcctttctggagaagactgggtttgtagatgaaactgaagctgccaaagtggaacgtgtgaaacaggaaaaaggtattttctgggaaccctttgctaatgtgactgtagaagaagcaaagaggtcatctttacagccttatgcaaaaagagctcgtcaggagttcccctgggaagaagagtacaggtcagcgctgcatacaatagcaggggctttggaagcaactgagtcactactccaaaagggtcctgctccagcctggctttcaatggaaatggaggcgctccaagaaaggatggataagctaaaacgttacatacatactctagggtgaaacttatcactaggcagaactgggtttgatgctttgtcaactgaaaatacttatgtctgtacattttctaacagatataaaacaaattttgtaaagttgaa
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.