Home |
Help |
Advanced search
2025-05-09 19:11:22, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018186 3363 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens chromosome 1 open reading frame 112 (C1orf112), mRNA.
ACCESSION NM_018186
VERSION NM_018186.2 GI:40254930
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3363)
AUTHORS van Dam,S., Cordeiro,R., Craig,T., van Dam,J., Wood,S.H. and de
Magalhaes,J.P.
TITLE GeneFriends: an online co-expression analysis tool to identify
novel gene targets for aging and complex diseases
JOURNAL BMC Genomics 13, 535 (2012)
PUBMED 23039964
REMARK GeneRIF: Knockdown of C1orf112 by siRNA in HeLa cells significantly
suppressed their growth.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 3363)
AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
TITLE Follow-up of a major linkage peak on chromosome 1 reveals
suggestive QTLs associated with essential hypertension: GenNet
study
JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
PUBMED 19536175
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 3 (bases 1 to 3363)
AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
genetic association with bone mineral density variation
JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009)
PUBMED 19064610
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT PREDICTED REFSEQ: This record has not been reviewed and the
function is unknown. The reference sequence was derived from
AL354614.1.
On Dec 20, 2003 this sequence version replaced gi:8922604.
##Evidence-Data-START##
Transcript exon combination :: AL354614.1, BC107169.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025085 [ECO:0000348]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..3363
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q24.2"
gene 1..3363
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="chromosome 1 open reading frame 112"
/db_xref="GeneID:55732"
/db_xref="HGNC:25565"
/db_xref="HPRD:07694"
exon 1..575
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
misc_feature 1..493
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AI636820 from clone IMAGE:2232951;
matches EST AI143214 from clone IMAGE:1705654"
misc_feature 1..489
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA045249 from clone IMAGE:376624"
misc_feature 1..419
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA505146 from clone IMAGE:825821"
misc_feature 1..374
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA978262 from clone IMAGE:1579851"
misc_feature 1..352
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST R42858 from clone IMAGE:31462"
misc_feature 1..314
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA844031 from clone IMAGE:1388232"
misc_feature 1..299
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AI221282 from clone IMAGE:1842585"
misc_feature 1..229
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA256694 from clone IMAGE:682325"
misc_feature 1..199
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AI625350 from clone IMAGE:2230748"
misc_feature 2..272
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA535882 from clone IMAGE:927171"
misc_feature 4..521
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AI677860 from clone IMAGE:2330028"
variation 19
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:3766132"
variation 40
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:115359649"
variation 77
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144721759"
variation 87..88
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="t"
/db_xref="dbSNP:148426326"
variation 317
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368204885"
variation 339
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:77972416"
variation 346
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:182053931"
variation 375..378
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="ttct"
/db_xref="dbSNP:199527192"
variation 377..380
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="cttt"
/db_xref="dbSNP:376222023"
variation 442
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:113859366"
variation 443
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="g"
/db_xref="dbSNP:72514418"
variation 443
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:74231893"
variation 444..445
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="g"
/db_xref="dbSNP:33911820"
variation 467
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:16862695"
variation 503
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:10919246"
exon 576..677
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 611
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:6680938"
misc_feature 626..628
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="upstream in-frame stop codon"
variation 658
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:6668114"
exon 678..766
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
CDS 701..3262
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/codon_start=1
/product="uncharacterized protein C1orf112"
/protein_id="NP_060656.2"
/db_xref="GI:40254931"
/db_xref="CCDS:CCDS1285.1"
/db_xref="GeneID:55732"
/db_xref="HGNC:25565"
/db_xref="HPRD:07694"
/translation="
MFLPHMNHLTLEQTFFSQVLPKTVKLFDDMMYELTSQARGLSSQNLEIQTTLRNILQTMVQLLGALTGCVQHICATQESIILENIQSLPSSVLHIIKSTFVHCKNSESVYSGCLHLVSDLLQALFKEAYSLQKQLMELLDMVCMDPLVDDNDDILNMVIVIHSLLDICSVISSMDHAFHANTWKFIIKQSLKHQSIIKSQLKHKDIITSLCEDILFSFHSCLQLAEQMTQSDAQDNADYRLFQKTLKLCRFFANSLLHYAKEFLPFLSDSCCTLHQLYLQIHSKFPPSLYATRISKAHQEEIAGAFLVTLDPLISQLLTFQPFMQVVLDSKLDLPCELQFPQCLLLVVVMDKLPSQPKEVQTLWCTDSQVSETTTRISLLKAVFYSFEQCSGELSLPVHLQGLKSKGKAEVAVTLYQHVCVHLCTFITSFHPSLFAELDAALLNAVLSANMITSLLAMDAWCFLARYGTAELCAHHVTIVAHLIKSCPGECYQLINLSILLKRLFFFMAPPHQLEFIQKFSPKEAENLPLWQHISFQALPPELREQTVHEVTTVGTAECRKWLSRSRTLGELESLNTVLSALLAVCNSAGEALDTGKQTAIIEVVSQLWAFLNIKQVADQPYVQQTFSLLLPLLGFFIQTLDPKLILQAVTLQTSLLKLELPDYVRLAMLDFVSSLGKLFIPEAIQDRILPNLSCMFALLLADRSWLLEQHTLEAFTQFAEGTNHEEIVPQCLSSEETKNKVVSFLEKTGFVDETEAAKVERVKQEKGIFWEPFANVTVEEAKRSSLQPYAKRARQEFPWEEEYRSALHTIAGALEATESLLQKGPAPAWLSMEMEALQERMDKLKRYIHTLG
"
misc_feature 3074..3076
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/experiment="experimental evidence, no additional details
recorded"
/note="N6-acetyllysine; propagated from
UniProtKB/Swiss-Prot (Q9NSG2.1); acetylation site"
variation 713
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:150100828"
exon 767..871
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 823
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:375959152"
variation 838
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:368991312"
exon 872..1012
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 900
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138640089"
variation 901
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:201977022"
variation 928
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146229767"
variation 932
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373199422"
variation 935
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:376177124"
variation 952
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:186128009"
variation 959
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144274713"
variation 961
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148755847"
variation 964
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:151250010"
variation 978
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200555038"
variation 996
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:180687535"
exon 1013..1178
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1018
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:201023910"
variation 1023
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:201886828"
variation 1027
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147711417"
variation 1041
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:370208533"
variation 1114
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:11590604"
variation 1128
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:144946376"
variation 1131
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:374141112"
variation 1134
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199744208"
variation 1148
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:143006454"
variation 1171
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:367824430"
exon 1179..1263
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1182
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:145543630"
variation 1225
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:192980177"
variation 1242
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144983355"
exon 1264..1402
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1313
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371455881"
variation 1325
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:74953085"
variation 1330
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:200466685"
variation 1365
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:139732947"
variation 1395
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113981899"
exon 1403..1483
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1407
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:375877474"
variation 1477
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:112569201"
exon 1484..1548
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1499
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372665901"
variation 1517
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:144662128"
variation 1534
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200701654"
exon 1549..1697
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1554
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142988055"
variation 1635
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377480387"
variation 1644
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371775846"
variation 1655
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:5019203"
exon 1698..1827
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1705
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:149832132"
variation 1726
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201673352"
variation 1733
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373868174"
variation 1756
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141070074"
variation 1777
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147902019"
variation 1800
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:151303105"
variation 1807
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:149698707"
variation 1810
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:199711855"
variation 1818
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:368806580"
exon 1828..2014
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 1847
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199972566"
variation 1852
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:370645133"
variation 1868
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140223103"
variation 1901
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202166855"
variation 1937
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:373215763"
variation 1952
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377308166"
exon 2015..2097
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
misc_feature 2055..2281
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA372264"
variation 2072
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:375726175"
exon 2098..2149
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2134
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369383155"
variation 2135
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:202022925"
variation 2141
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:2272920"
variation 2144
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373319656"
exon 2150..2239
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2186
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201956753"
variation 2206
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373018255"
variation 2207
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376471585"
variation 2231
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:199924835"
exon 2240..2425
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2284
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:370624050"
variation 2286
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374739512"
variation 2314
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372445850"
variation 2319
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375547099"
variation 2392
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:368600637"
variation 2399
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141448631"
variation 2400
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:138421783"
exon 2426..2548
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2432
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:376679451"
variation 2442
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369137831"
variation 2465
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:111505483"
variation 2488
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147256909"
variation 2493
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:202036615"
variation 2498
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149853039"
variation 2502
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:199686999"
variation 2514
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375124353"
misc_feature 2517..3021
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA045214 from clone IMAGE:376624"
exon 2549..2644
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2553
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:185940964"
variation 2562
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144964944"
variation 2566
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376331059"
variation 2599
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:373692979"
variation 2608
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371749853"
variation 2630
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:370430649"
misc_feature 2634..3091
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA491378 from clone IMAGE:825821"
exon 2645..2758
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2684
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372502659"
misc_feature 2694..2760
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST W20092 from clone IMAGE:305970"
variation 2697
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146693956"
variation 2752
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143961599"
variation 2757
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:181455874"
exon 2759..2863
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2772
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:141083239"
misc_feature 2781..3198
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AA255801 from clone IMAGE:682325"
variation 2798
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199894284"
variation 2845
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:138665936"
variation 2849
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368545217"
variation 2857
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143577187"
exon 2864..2944
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2873
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:200039690"
variation 2883
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="g"
/replace="t"
/db_xref="dbSNP:372992913"
variation 2884
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143920166"
exon 2945..3064
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 2949
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:74523449"
variation 2985
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:139434399"
variation 2986
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:116769474"
variation 2993
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:373731734"
variation 3034
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:377477768"
variation 3042
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="c"
/db_xref="dbSNP:149928320"
variation 3048
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374190475"
exon 3065..3363
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/inference="alignment:Splign:1.39.8"
variation 3065
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:200810095"
variation 3083
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:371038958"
variation 3120
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374472770"
variation 3121
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:374957147"
misc_feature 3138..3281
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/note="matches EST AI630082 from clone ad01d11"
variation 3181
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:370575837"
STS 3208..3313
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/standard_name="SHGC-75871"
/db_xref="UniSTS:16040"
variation 3211
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:191037390"
variation 3222
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:41308405"
variation 3223
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:367920603"
variation 3269
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="t"
/db_xref="dbSNP:372516539"
variation 3274..3275
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="ggcagaact"
/db_xref="dbSNP:112674836"
variation 3274
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:76988021"
variation 3276..3277
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace=""
/replace="cagaactgg"
/replace="gcagaactg"
/db_xref="dbSNP:71840872"
variation 3286
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="c"
/replace="g"
/db_xref="dbSNP:199793803"
variation 3287
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="t"
/db_xref="dbSNP:200209646"
variation 3361
/gene="C1orf112"
/gene_synonym="RP1-97P20.1"
/replace="a"
/replace="g"
/db_xref="dbSNP:3180650"
ORIGIN
ggctttggccctggaaagcctcgcggacgtgttctgacccaaggttttagcagtggatgtggcgttttcttccattccttctttcagtttttctgtactcgttgcttgcaattaagtgtaaatacttttgctagtggataatgggggaggcaaggactgagacctgcggtatgacgatagctctggctcttaatagtttgaggtaaagcgagatactctgagcttttgtctcccgtaaaaagggtggtgaatatgaataagggctttcttagcgttataagaattaaagggcatagttctgtggtgtgaaatctttaaaagatgttcagtaaataaaaatgattttcctccttcccctctcagacctctttttcttctttctttctttttttttgacaagttctcactcctctcacccaggctggagtctttctgaaagagttcttccgcttgttgttggctttcaactgttggatttgaggcgcttagcgccttcttcgtccgggtgcagcacattcttgattggtctcatgcctttgtggttgtaaatgtgcctggaatcctagcctttcatggtttgttctgagtaatgaataccctattactatgatactagtatcttccttaattatcctactcattgtctcaacattctgacagttggattgagcatattcaaattttgaaaattattgtagaaatgtttttacctcatatgaaccacctgacattggaacagactttcttttcacaagtgttaccaaagactgtgaaattattcgatgacatgatgtatgaattaaccagtcaagccagaggactgtcaagccaaaatttggaaatccagaccactctaaggaatattttacaaacaatggtgcagctcttaggagctctcacaggatgtgttcagcatatctgtgccacacaggaatccatcattttggaaaatattcagagtctcccctcctcagtccttcatataattaaaagcacatttgtgcattgtaagaatagtgaatctgtgtattctgggtgtttacacctagtttcagaccttctccaggctcttttcaaggaggcctattctcttcaaaagcagttaatggaactgctggacatggtttgcatggaccctttagtagatgacaatgatgatattttgaatatggtaatagttattcattctttattggatatctgctctgttatttccagtatggaccatgcatttcatgccaatacttggaagtttataattaagcagagccttaagcaccagtccataataaaaagccagttgaaacacaaagatataattactagcttgtgtgaagacattcttttctccttccattcttgtttacagttagctgagcagatgacacagtcagatgcacaggataatgctgactacagattatttcagaaaacactcaaattgtgtcgtttttttgccaactcccttttgcactacgctaaggaatttcttcctttcctctctgattcttgctgtactttgcaccaactgtatcttcagatacacagcaagtttcctccaagcctttatgctaccaggatttctaaagcacaccaagaggaaatagcaggtgctttcctagtgacactggatccacttatcagtcagctgctcacatttcagcctttcatgcaggtggttttggacagtaaattagacctgccatgtgaactgcagtttccacaatgtcttcttctggttgttgtcatggataagctgccatctcagcctaaggaagtgcaaaccctgtggtgcacagacagccaggtctcagaaacgacaaccaggatatctctactcaaagccgttttctacagttttgagcagtgttctggtgaactctctctacctgttcatttacagggattaaagagtaaggggaaagctgaggtggctgtcaccttgtatcagcatgtttgtgttcatctgtgtacatttattacttcctttcatccctcactgtttgctgaactggatgctgctctgctgaatgctgtacttagtgctaatatgatcacctctttgttagctatggatgcatggtgcttccttgctcgatatgggactgctgaactgtgtgcacaccatgtcaccatagtggctcatctgataaagtcatgccctggagaatgttatcaactcatcaacctatcaatactgttgaagcgtctctttttcttcatggcaccaccccatcagctggagtttatccagaaattttccccaaaagaagcagaaaatctgcctctgtggcaacatatttccttccaggcgttacctcctgagcttagggaacaaactgtccatgaggtcaccacagtaggcactgcagaatgcaggaaatggctgagcaggagtcgtactttgggagaactagaatctctgaacacagtactgtctgctttgcttgcagtatgtaattctgctggtgaagctttggatacaggaaaacaaactgcaattatcgaagttgtgagtcagctttgggcttttttaaacattaaacaggtagcagatcaaccttatgttcaacagacattcagccttttacttccactgttgggatttttcattcaaactctagatcctaaactgatacttcaggcagtaactttgcagacctcgctacttaaattagagcttcctgactatgttcgtttggcaatgttggattttgtatcttctttaggaaaactttttatacctgaagctatccaggacagaattctgcccaacctgtcctgtatgtttgccttactgctagctgacaggagttggctgctagaacaacataccttggaggcgtttactcagttcgctgagggaacaaatcatgaagagatagttccacagtgtctcagttctgaagaaactaagaacaaagttgtatcctttctggagaagactgggtttgtagatgaaactgaagctgccaaagtggaacgtgtgaaacaggaaaaaggtattttctgggaaccctttgctaatgtgactgtagaagaagcaaagaggtcatctttacagccttatgcaaaaagagctcgtcaggagttcccctgggaagaagagtacaggtcagcgctgcatacaatagcaggggctttggaagcaactgagtcactactccaaaagggtcctgctccagcctggctttcaatggaaatggaggcgctccaagaaaggatggataagctaaaacgttacatacatactctagggtgaaacttatcactaggcagaactgggtttgatgctttgtcaactgaaaatacttatgtctgtacattttctaacagatataaaacaaattttgtaaagttgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.