Home |
Help |
Advanced search
2025-05-09 19:27:35, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018179 4661 bp mRNA linear PRI 15-JUN-2013
DEFINITION Homo sapiens activating transcription factor 7 interacting protein
(ATF7IP), mRNA.
ACCESSION NM_018179 NM_018005
VERSION NM_018179.3 GI:38261961
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4661)
AUTHORS Jin,G., Zheng,S.L., Lilja,H., Kim,S.T., Tao,S., Gao,Z., Young,T.,
Wiklund,F., Feng,J., Isaacs,W.B., Rittmaster,R.S., Gronberg,H.,
Condreay,L.D., Sun,J. and Xu,J.
TITLE Genome-wide association study identifies loci at ATF7IP and KLK2
associated with percentage of circulating free PSA
JOURNAL Neoplasia 15 (1), 95-101 (2013)
PUBMED 23359319
REFERENCE 2 (bases 1 to 4661)
AUTHORS Turnbull,C., Rapley,E.A., Seal,S., Pernet,D., Renwick,A.,
Hughes,D., Ricketts,M., Linger,R., Nsengimana,J., Deloukas,P.,
Huddart,R.A., Bishop,D.T., Easton,D.F., Stratton,M.R. and Rahman,N.
CONSRTM UK Testicular Cancer Collaboration
TITLE Variants near DMRT1, TERT and ATF7IP are associated with testicular
germ cell cancer
JOURNAL Nat. Genet. 42 (7), 604-607 (2010)
PUBMED 20543847
REMARK GeneRIF: Studies identified three new susceptibility loci DMRT1,
TERT and ATF7IP associated with testicular germ cell cancer.
GeneRIF: Observational study and genome-wide association study of
gene-disease association. (HuGE Navigator)
REFERENCE 3 (bases 1 to 4661)
AUTHORS Liu,L., Ishihara,K., Ichimura,T., Fujita,N., Hino,S., Tomita,S.,
Watanabe,S., Saitoh,N., Ito,T. and Nakao,M.
TITLE MCAF1/AM is involved in Sp1-mediated maintenance of
cancer-associated telomerase activity
JOURNAL J. Biol. Chem. 284 (8), 5165-5174 (2009)
PUBMED 19106100
REMARK GeneRIF: Two evolutionarily conserved domains of MCAF1 directly
interact with Sp1 and the general transcriptional apparatus.
Selective depletion of MCAF1 or Sp1 down-regulates TERT and TERC
genes in cultured cells, which results in decreased telomerase
activity.
REFERENCE 4 (bases 1 to 4661)
AUTHORS Sekiyama,N., Ikegami,T., Yamane,T., Ikeguchi,M., Uchimura,Y.,
Baba,D., Ariyoshi,M., Tochio,H., Saitoh,H. and Shirakawa,M.
TITLE Structure of the small ubiquitin-like modifier (SUMO)-interacting
motif of MBD1-containing chromatin-associated factor 1 bound to
SUMO-3
JOURNAL J. Biol. Chem. 283 (51), 35966-35975 (2008)
PUBMED 18842587
REMARK GeneRIF: the acidic stretch of the SIM of MCAF1 plays an important
role in the binding to SUMO-3.
REFERENCE 5 (bases 1 to 4661)
AUTHORS Uchimura,Y., Ichimura,T., Uwada,J., Tachibana,T., Sugahara,S.,
Nakao,M. and Saitoh,H.
TITLE Involvement of SUMO modification in MBD1- and MCAF1-mediated
heterochromatin formation
JOURNAL J. Biol. Chem. 281 (32), 23180-23190 (2006)
PUBMED 16757475
REMARK GeneRIF: MBD1- and MCAF1-mediated heterochromatin formation
involves SUMO modification
REFERENCE 6 (bases 1 to 4661)
AUTHORS Morris,J.A., Kandpal,G., Ma,L. and Austin,C.P.
TITLE DISC1 (Disrupted-In-Schizophrenia 1) is a centrosome-associated
protein that interacts with MAP1A, MIPT3, ATF4/5 and NUDEL:
regulation and loss of interaction with mutation
JOURNAL Hum. Mol. Genet. 12 (13), 1591-1608 (2003)
PUBMED 12812986
REFERENCE 7 (bases 1 to 4661)
AUTHORS Yamada,K., Kawata,H., Shou,Z., Hirano,S., Mizutani,T., Yazawa,T.,
Sekiguchi,T., Yoshino,M., Kajitani,T. and Miyamoto,K.
TITLE Analysis of zinc-fingers and homeoboxes (ZHX)-1-interacting
proteins: molecular cloning and characterization of a member of the
ZHX family, ZHX3
JOURNAL Biochem. J. 373 (PT 1), 167-178 (2003)
PUBMED 12659632
REFERENCE 8 (bases 1 to 4661)
AUTHORS Fujita,N., Watanabe,S., Ichimura,T., Ohkuma,Y., Chiba,T., Saya,H.
and Nakao,M.
TITLE MCAF mediates MBD1-dependent transcriptional repression
JOURNAL Mol. Cell. Biol. 23 (8), 2834-2843 (2003)
PUBMED 12665582
REFERENCE 9 (bases 1 to 4661)
AUTHORS Gunther,M., Laithier,M. and Brison,O.
TITLE A set of proteins interacting with transcription factor Sp1
identified in a two-hybrid screening
JOURNAL Mol. Cell. Biochem. 210 (1-2), 131-142 (2000)
PUBMED 10976766
REFERENCE 10 (bases 1 to 4661)
AUTHORS De Graeve,F., Bahr,A., Chatton,B. and Kedinger,C.
TITLE A murine ATFa-associated factor with transcriptional repressing
activity
JOURNAL Oncogene 19 (14), 1807-1819 (2000)
PUBMED 10777215
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK025060.1, AK074868.1, BX648096.1 and AK027575.1.
On Nov 12, 2003 this sequence version replaced gi:34996492.
Summary: ATF7IP is a multifunctional nuclear protein that
associates with heterochromatin. It can act as a transcriptional
coactivator or corepressor depending upon its binding partners
(summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM,
Nov 2010].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
CDS exon combination :: BX648096.1, AF425650.1 [ECO:0000331]
RNAseq introns :: single sample supports all introns
ERS025081, ERS025082 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-650 AK025060.1 3-652
651-1201 AK074868.1 1-551
1202-1743 AK025060.1 1204-1745
1744-2877 BX648096.1 1654-2787
2878-4431 AK027575.1 1133-2686
4432-4661 BX648096.1 4342-4571
FEATURES Location/Qualifiers
source 1..4661
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="12"
/map="12p13.1"
gene 1..4661
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/note="activating transcription factor 7 interacting
protein"
/db_xref="GeneID:55729"
/db_xref="HGNC:20092"
/db_xref="HPRD:09811"
/db_xref="MIM:613644"
exon 1..151
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 45
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:151278854"
variation 48
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:34690889"
variation 65
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:34551060"
misc_feature 66..68
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/note="upstream in-frame stop codon"
exon 152..1716
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
CDS 159..3971
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/note="MBD1-containing chromatin associated factor;
MBD1-containing chromatin-associated factor 1; hAM;
ATF-IP; ATF-interacting protein; ATFa-associated
modulator; ATF7-interacting protein"
/codon_start=1
/product="activating transcription factor 7-interacting
protein 1"
/protein_id="NP_060649.3"
/db_xref="GI:38261962"
/db_xref="CCDS:CCDS8663.1"
/db_xref="GeneID:55729"
/db_xref="HGNC:20092"
/db_xref="HPRD:09811"
/db_xref="MIM:613644"
/translation="
MDSLEEPQKKVFKARKTMRVSDRQQLEAVYKVKEELLKTDVKLLNGNHENGDLDPTSPLENMDYIKDKEEVNGIEEICFDPEGSKAEWKETPCILSVNVKNKQDDDLNCEPLSPHNITPEPVSKLPAEPVSGDPAPGDLDAGDPASGVLASGDSTSGDPTSSEPSSSDAASGDATSGDAPSGDVSPGDATSGDATADDLSSGDPTSSDPIPGEPVPVEPISGDCAADDIASSEITSVDLASGAPASTDPASDDLASGDLSSSELASDDLATGELASDELTSESTFDRTFEPKSVPVCEPVPEIDNIEPSSNKDDDFLEKNGADEKLEQIQSKDSLDEKNKADNNIDANEETLETDDTTICSDRPPENEKKVEEDIITELALGEDAISSSMEIDQGEKNEDETSADLVETINENVIEDNKSENILENTDSMETDEIIPILEKLAPSEDELTCFSKTSLLPIDETNPDLEEKMESSFGSPSKQESSESLPKEAFLVLSDEEDISGEKDESEVISQNETCSPAEVESNEKDNKPEEEEQVIHEDDERPSEKNEFSRRKRSKSEDMDNVQSKRRRYMEEEYEAEFQVKITAKGDINQKLQKVIQWLLEEKLCALQCAVFDKTLAELKTRVEKIECNKRHKTVLTELQAKIARLTKRFEAAKEDLKKRHEHPPNPPVSPGKTVNDVNSNNNMSYRNAGTVRQMLESKRNVSESAPPSFQTPVNTVSSTNLVTPPAVVSSQPKLQTPVTSGSLTATSVLPAPNTATVVATTQVPSGNPQPTISLQPLPVILHVPVAVSSQPQLLQSHPGTLVTNQPSGNVEFISVQSPPTVSGLTKNPVSLPSLPNPTKPNNVPSVPSPSIQRNPTASAAPLGTTLAVQAVPTAHSIVQATRTSLPTVGPSGLYSPSTNRGPIQMKIPISAFSTSSAAEQNSNTTPRIENQTNKTIDASVSKKAADSTSQCGKATGSDSSGVIDLTMDDEESGASQDPKKLNHTPVSTMSSSQPVSRPLQPIQPAPPLQPSGVPTSGPSQTTIHLLPTAPTTVNVTHRPVTQVTTRLPVPRAPANHQVVYTTLPAPPAQAPLRGTVMQAPAVRQVNPQNSVTVRVPQTTTYVVNNGLTLGSTGPQLTVHHRPPQVHTEPPRPVHPAPLPEAPQPQRLPPEAASTSLPQKPHLKLARVQSQNGIVLSWSVLEVDRSCATVDSYHLYAYHEEPSATVPSQWKKIGEVKALPLPMACTLTQFVSGSKYYFAVRAKDIYGRFGPFCDPQSTDVISSTQSS
"
misc_feature 495..497
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 495..497
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 510..512
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q6VMQ6.3); phosphorylation site"
misc_feature <1050..1463
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/note="AAA ATPase containing von Willebrand factor type A
(vWA) domain [General function prediction only]; Region:
MDN1; COG5271"
/db_xref="CDD:34868"
misc_feature 1575..1577
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 1587..1589
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 1644..1646
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 1644..1646
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1815..1871
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6VMQ6.3);
Region: Nuclear localization signal (By similarity)"
misc_feature 1833..1835
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 1842..2609
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6VMQ6.3);
Region: Interaction with SETDB1"
misc_feature 2175..2177
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 2175..2177
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2853..2855
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q6VMQ6.3); phosphorylation site"
misc_feature 3051..3083
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6VMQ6.3);
Region: Interaction with SUMO"
misc_feature 3618..3968
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q6VMQ6.3);
Region: Interaction with MBD1"
STS 186..259
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/standard_name="1552"
/db_xref="UniSTS:1694"
variation 215
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:201779105"
variation 290
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:371570170"
variation 301
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:377285012"
variation 344
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:140946450"
variation 385
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:369829841"
variation 392
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="t"
/db_xref="dbSNP:71765215"
variation 444
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:372446317"
variation 502
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:200012406"
variation 543
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:146816712"
variation 566
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:369467327"
variation 574
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:200853057"
variation 581
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:150180233"
variation 597
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:140582861"
variation 603
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:145645055"
variation 608
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:377163716"
variation 633
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:150179759"
variation 635
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:138640294"
variation 640
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:202238899"
variation 645
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:369048586"
variation 664
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:372435035"
variation 677
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:2231907"
variation 696
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:201041318"
variation 698
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:141345802"
variation 709
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:199558661"
variation 710
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:200596410"
variation 711
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:201786435"
variation 714
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:200116386"
variation 762
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:201516379"
variation 768
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:113196746"
variation 780
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:376462723"
variation 792
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:370905234"
variation 800
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:373638599"
variation 816
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:138811977"
variation 833
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:146972131"
variation 834
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:138035183"
variation 906
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:371142536"
variation 907
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:200357962"
variation 918
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:373479512"
variation 922
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:143487104"
variation 949
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:376822963"
variation 951
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:367924205"
variation 990
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:2231908"
variation 1017
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:146013763"
variation 1018
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:148205796"
variation 1056
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:141145293"
variation 1067
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:374719436"
variation 1072
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:200034121"
variation 1081
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:368557002"
variation 1090
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:138650922"
variation 1127
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:112796702"
variation 1160
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:114032760"
variation 1201
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:2231909"
variation 1222
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:372164415"
variation 1245
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:189410213"
variation 1253
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:368489982"
variation 1280
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:372397201"
variation 1300
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:375320471"
variation 1322
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:113285812"
variation 1325
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:369118957"
variation 1351
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:372543706"
variation 1384
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:146351562"
variation 1385
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:373563379"
variation 1429
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:377580853"
variation 1452
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:370506660"
variation 1529
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:61754405"
variation 1536
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:374867725"
variation 1538
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:367845683"
variation 1541
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:369828123"
variation 1563
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:200627232"
variation 1663
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:111490805"
variation 1693
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:374561365"
variation 1700
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:79133757"
variation 1706
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:368662684"
exon 1717..1803
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 1735
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:370379417"
variation 1744
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:145246872"
variation 1747
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:3213764"
variation 1749
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:372036691"
variation 1763
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:142252576"
variation 1775
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:375070737"
variation 1799
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:151223624"
exon 1804..1949
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 1817
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:373009081"
variation 1823
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:141409610"
variation 1849
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:375922399"
variation 1877
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:61758731"
exon 1950..2087
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 1950
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:201415676"
variation 1977
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:138145099"
variation 1985
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:61754406"
variation 1991
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:373169074"
variation 2060
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:377610222"
exon 2088..2153
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 2114
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:150124510"
exon 2154..2227
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 2182
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:374172651"
variation 2200
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:138421158"
exon 2228..2316
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 2240
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:202062208"
variation 2250
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:113399244"
variation 2285
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:149245710"
variation 2286
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:73058771"
exon 2317..2955
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 2359
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:74069866"
variation 2372
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:140561687"
variation 2389..2390
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="g"
/db_xref="dbSNP:34991767"
variation 2390
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:374075959"
variation 2394
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:201295438"
variation 2396
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:183782658"
variation 2401
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:367726461"
variation 2408
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:139022855"
variation 2430
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:142279964"
variation 2474
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:369912046"
variation 2519
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:71530944"
variation 2564
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:113845516"
variation 2588
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:61754407"
variation 2667
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:74980854"
variation 2695
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:139730920"
variation 2728
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:149778571"
variation 2736
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:145691516"
variation 2737
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:377226980"
variation 2751
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:202095197"
variation 2805
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:199961592"
variation 2858
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:199558423"
variation 2867
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:200027283"
variation 2901
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:374093724"
variation 2920
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:201804224"
variation 2944
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:377586677"
exon 2956..3020
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 2963..2964
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="c"
/db_xref="dbSNP:35282582"
variation 2976
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:376387105"
variation 2987
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:113938032"
exon 3021..3099
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 3024
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:377288237"
variation 3068
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:141529532"
variation 3085
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:200505464"
exon 3100..3255
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 3162
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:145312310"
variation 3187
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:147638471"
variation 3188
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:61754408"
variation 3189
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:143106717"
variation 3243
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:151175064"
exon 3256..3438
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 3261
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:369237380"
variation 3318
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:372442847"
variation 3340
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:376465819"
variation 3363
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:71530945"
variation 3369
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:138654752"
variation 3400
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:377414778"
variation 3402
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:202156107"
variation 3414
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:150319310"
exon 3439..3551
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 3442
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:137897287"
variation 3470
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:61754409"
variation 3516..3517
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="t"
/db_xref="dbSNP:35873202"
variation 3523
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:370384639"
variation 3532
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:145917898"
variation 3547
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:200404655"
exon 3552..4661
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/inference="alignment:Splign:1.39.8"
variation 3561
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:138456753"
variation 3573
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:367656414"
variation 3610
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:374729561"
variation 3613
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:368535237"
STS 3630..4353
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/standard_name="ATF7IP_3606"
/db_xref="UniSTS:462043"
variation 3668
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:369961485"
variation 3721
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:149615634"
variation 3742
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:372946923"
variation 3783
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="g"
/db_xref="dbSNP:375823854"
variation 3848
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:144323399"
variation 3915
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:75697211"
variation 3954
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:371926275"
variation 4085
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:368414324"
variation 4099
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:187666120"
variation 4114
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:190906557"
variation 4169
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:34370668"
variation 4317
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:371284543"
variation 4380
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:138839070"
variation 4432..4435
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="aaat"
/db_xref="dbSNP:141728087"
variation 4432
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="aaat"
/db_xref="dbSNP:67352529"
variation 4435..4438
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="taaa"
/db_xref="dbSNP:377640869"
variation 4435
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:80123483"
variation 4437..4439
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="aat"
/db_xref="dbSNP:201966946"
variation 4439
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="t"
/db_xref="dbSNP:200905088"
variation 4439
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace=""
/replace="t"
/replace="taaa"
/db_xref="dbSNP:10524936"
variation 4442
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:367892501"
variation 4446
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="c"
/db_xref="dbSNP:371594127"
variation 4518
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="g"
/replace="t"
/db_xref="dbSNP:370119231"
variation 4552
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="c"
/replace="t"
/db_xref="dbSNP:182091278"
variation 4556
/gene="ATF7IP"
/gene_synonym="AM; MCAF; MCAF1; p621"
/replace="a"
/replace="g"
/db_xref="dbSNP:79941046"
ORIGIN
tttttgaatctgcggaggcggcggcggtggcagcggcggcgcggcgactgaagcgcgcgaaaagctgaggcggcaacgtcggggacggctgcgcgggacggctctgtaggaaggaacttggttccccctccctcagcttccgccccaaaagattcagaatggacagtttagaagaacctcagaaaaaagtctttaaggctcgaaaaacgatgagagtgagtgatcgtcagcaacttgaagcagtgtacaaggtcaaagaagaactgttgaaaactgatgtcaagctgttaaatggcaaccatgaaaatggagatttggacccaacctcacctttggaaaacatggattacattaaagacaaggaagaggtgaatggcattgaagagatttgttttgatcctgaaggaagtaaagcagaatggaaggaaacaccctgtatcctaagtgttaatgtaaaaaacaagcaggatgatgatttaaattgtgaacctttgtctccccataatataactccagaaccagtctctaaactgcctgctgaaccagtttctggtgatccagcccctggtgatctggatgccggagatccagcctccggagtactggcctctggtgattccacctctggtgatcccacctctagcgagccctcctctagtgatgctgcctctggtgatgcaacctctggtgatgccccttctggtgatgtgtcccctggtgatgccacctctggtgatgccactgctgatgatctctcctctggtgatcccacctctagtgatcccatcccaggtgaaccggtccctgttgaacccatttctggtgattgtgccgctgatgatatagcctctagtgaaataacttctgttgatctggcttctggagcaccagcttccactgatccagcctctgatgatctggcctctggtgatctatcctctagtgaactggcctctgatgatctggccactggtgaactggcctctgatgagctgacttctgaatcaacctttgatcgtacctttgaaccaaagtctgtaccagtttgtgaaccagttcctgaaattgacaatatagaaccaagtagcaataaagatgatgattttcttgaaaaaaatggagctgatgaaaaattagagcaaattcagagtaaagactcattggatgagaaaaataaagctgataataatattgatgctaatgaagaaactctagaaacagatgatacaactatttgttcagatcgacctcctgaaaatgaaaagaaggtagaggaagatattatcacagagcttgctcttggagaagatgctatatctagcagtatggaaattgaccaaggtgaaaagaatgaagatgaaacttctgcagatcttgtagaaacgattaatgaaaatgttattgaagataacaaaagtgagaatatcttagaaaatacagactctatggagacagatgaaatcattcctattttggaaaagcttgcaccttctgaggatgaacttacttgcttttctaaaacatctctccttccaatcgatgagacaaatccagatttggaagagaaaatggaaagttcttttggttcaccatctaaacaagaaagtagtgagagtttgccaaaagaagcctttctggtcctctctgatgaagaggatatttcgggtgaaaaagatgagtctgaagttatatcgcaaaatgaaacgtgctctccagcagaagtagaaagtaatgaaaaggacaacaaacctgaggaagaagagcaagtaatacatgaagatgatgaaagaccttctgagaaaaatgaattttctagacgaaaacgttctaaatcagaagacatggacaatgtacagtctaaacgtcgtcgatatatggaagaagaatatgaggcagaatttcaagtaaagattacagccaaaggagacattaaccagaaacttcaaaaggttatacagtggttgctggaagaaaaattgtgtgcgctgcagtgtgctgtatttgataagactttggcagaattgaaaacacgagtggaaaagattgaatgtaacaagaggcataaaacagttctcactgaactacaggccaagatagccaggttaaccaaacgctttgaagcagccaaagaagatcttaagaaaagacatgaacatccacccaacccaccagtatcaccaggaaaaactgtaaatgatgtcaacagcaataataacatgtcttacagaaatgcaggcacagtgagacagatgctggagtccaaaagaaatgtaagcgagagtgcaccaccatcctttcaaactcctgtgaatacagtatcttcaaccaatcttgtcactcctccagcagttgtcagtagtcaacctaaattgcagactccagtgacttcgggttccctcacagcaacgtcagttcttcctgcacccaatacagctactgtagttgctactactcaggtgcctagtggaaatccccagcctacaatctctttacagcctttgccagtgattttgcatgtacctgttgcagtatcctcccagcctcagcttctacagagccatccagggactttggtgactaatcaaccatctggcaatgttgaattcatttctgtgcaaagcccacctacagtgagtggtcttaccaaaaatccagtatccttgccatccttgccaaatcccactaaaccaaacaacgttccttctgtgcccagtcctagtattcaaaggaaccctactgccagtgctgcaccattgggaacaacacttgctgtgcaggctgttccaacagcacactctattgtacaagccacaaggacttctttacccacagtgggcccatcaggactctatagtccatcaactaatcgaggtcctatacagatgaaaattccaatttctgcatttagtacttcgtctgctgcagaacagaacagcaataccaccccaagaattgaaaaccagacaaacaaaacaatagatgcttctgtcagtaagaaagcagctgatagcacatcacagtgtggaaaagccactggcagtgattcaagtggtgtcattgatctcacaatggatgatgaagagagtggagcttcacaagaccccaaaaaactaaatcacactcctgtatcaaccatgagttcttctcagcctgtgtcacgaccattgcaacccatacaaccagcaccgcctcttcaaccatctggggtgccaacaagtggaccatctcagaccaccatacacttactacctacagctccaactaccgtgaatgtaacacatcgtccagtaactcaggtgaccacaagactccctgtaccaagagctcctgcaaaccaccaggtggtttatacaactcttcctgcaccaccagctcaggctcccttgcgaggaactgttatgcaggctcctgctgttcggcaggtcaatccccaaaatagtgttacagttcgagtgcctcaaacaaccacatatgttgtaaacaatggactaaccctgggatcaacaggacctcagctcacagtgcatcaccgaccaccacaagtgcatactgagcccccacgccccgtgcacccagcacccttaccagaagctccacaaccacagcgtctgcccccagaagctgccagcacatctctgcctcagaagccacacttgaagttagcacgcgttcagagtcaaaatggcatagtactgtcatggagtgtcctggaggtggatcgaagctgtgccactgttgatagctaccatctctatgcttaccatgaggaacccagtgccactgtgccctcacaatggaaaaagattggggaagtcaaggcacttcccttgcccatggcatgtactctcacccagtttgtatctggtagcaaatactactttgcagtacgagccaaggatatttatggacgttttgggcctttctgtgatcctcagtcaacagatgtgatctcttctacccagagcagttaaaccttggagcctttatattttcctcttttaaaatttccaccttttggtcttgtttttaatcttgtgcatgataccccatgtaaaatccaccttgtgcaagatttcttggacagatgtgtgtatacactacatttgtttataaccagaagcaaaataaactcagcccacaaagctagaatcttttcctggacagtttaggctttggggtttggaaatgtaaatgtgtaccttgctttagttttgaggctggggaatatgtgtgggtgtttatgtgtgtttttccttatgtaggtgttattgcattggagtctcccattttcattctcaaatttacctcttaaagtacgaagtaagtagatcaaaggatttgagatgtgtaactggcatgattctgcttttgaaggatctatagtatcattttagttaagtgggtcaaacagaatcaaaacaaaacccaaagaaataaataaaaaacaaaatggctaaatagtttaaaataggttaattcgaacacaggaaaggatctatttgttgtttcttttgtctggtctcctgagttgttaattaggtgaaaaaagatctgcaatggccccctccctttcctaatctggcttttacatttattttgtgccttaaagattaactacaaagataaacatggccaaaaataaataaataaatatggccata
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:55729 -> Molecular function: GO:0003714 [transcription corepressor activity] evidence: IEA
GeneID:55729 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:55729 -> Molecular function: GO:0016887 [ATPase activity] evidence: IEA
GeneID:55729 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
GeneID:55729 -> Biological process: GO:0006306 [DNA methylation] evidence: IDA
GeneID:55729 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:55729 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:55729 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
GeneID:55729 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: IDA
GeneID:55729 -> Biological process: GO:0045898 [regulation of RNA polymerase II transcriptional preinitiation complex assembly] evidence: IDA
GeneID:55729 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:55729 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.