GGRNA | NM_016358.2

LOCUS       NM_016358               2229 bp    mRNA    linear   PRI 04-JUL-2013
DEFINITION  Homo sapiens iroquois homeobox 4 (IRX4), transcript variant 5,
            mRNA.
ACCESSION   NM_016358
VERSION     NM_016358.2  GI:193211414
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2229)
  AUTHORS   Nguyen,H.H., Takata,R., Akamatsu,S., Shigemizu,D., Tsunoda,T.,
            Furihata,M., Takahashi,A., Kubo,M., Kamatani,N., Ogawa,O.,
            Fujioka,T., Nakamura,Y. and Nakagawa,H.
  TITLE     IRX4 at 5p15 suppresses prostate cancer growth through the
            interaction with vitamin D receptor, conferring prostate cancer
            susceptibility
  JOURNAL   Hum. Mol. Genet. 21 (9), 2076-2085 (2012)
   PUBMED   22323358
  REMARK    GeneRIF: the prostate cancer (PC)-susceptibility locus represented
            by rs12653946 at 5p15 is likely to regulate IRX4 expression in
            prostate which could suppress PC growth by interacting with the VDR
            pathway, conferring to PC susceptibility
REFERENCE   2  (bases 1 to 2229)
  AUTHORS   Cheng,Z., Wang,J., Su,D., Pan,H., Huang,G., Li,X., Li,Z., Shen,A.,
            Xie,X., Wang,B. and Ma,X.
  TITLE     Two novel mutations of the IRX4 gene in patients with congenital
            heart disease
  JOURNAL   Hum. Genet. 130 (5), 657-662 (2011)
   PUBMED   21544582
  REMARK    GeneRIF: IRX4 had a potential causative impact on the development
            of congenital heart disease, particularly ventricular septal
            defect.
REFERENCE   3  (bases 1 to 2229)
  AUTHORS   Schurks,M., Buring,J.E., Ridker,P.M., Chasman,D.I. and Kurth,T.
  TITLE     Genetic determinants of cardiovascular events among women with
            migraine: a genome-wide association study
  JOURNAL   PLoS ONE 6 (7), E22106 (2011)
   PUBMED   21779381
  REMARK    GeneRIF: Among migraineurs with aura rs7698623 in MEPE (OR = 6.37;
            95% CI 3.15-12.90; p = 2.7x10(-7)) and rs4975709 in IRX4 (OR =
            5.06; 95% CI 2.66-9.62; p = 7.7x10(-7)) appeared to be associated
            with ischemic stroke.
REFERENCE   4  (bases 1 to 2229)
  AUTHORS   Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B,
            Yusuf S, Gerstein HC, Engert JC and Anand S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   5  (bases 1 to 2229)
  AUTHORS   Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt
            TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M,
            Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ,
            Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S,
            Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD,
            Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE
            and Hingorani AD.
  CONSRTM   ASCOT investigators; NORDIL investigators; BRIGHT Consortium
  TITLE     Gene-centric association signals for lipids and apolipoproteins
            identified via the HumanCVD BeadChip
  JOURNAL   Am. J. Hum. Genet. 85 (5), 628-642 (2009)
   PUBMED   19913121
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   6  (bases 1 to 2229)
  AUTHORS   Bayrak,F., Komurcu-Bayrak,E., Mutlu,B., Kahveci,G. and
            Erginel-Unaltuna,N.
  TITLE     Genetic analysis of the Irx4 gene in hypertrophic cardiomyopathy
  JOURNAL   Turk Kardiyol Dern Ars 36 (2), 90-95 (2008)
   PUBMED   18497553
  REMARK    GeneRIF: Polymorphism A381>G of the Irx4 gene may have a modifier
            effect on septal thickness, resulting in increased corrected QT
            dispersion and higher outflow gradients.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 2229)
  AUTHORS   Wang,G.F., Nikovits,W. Jr., Bao,Z.Z. and Stockdale,F.E.
  TITLE     Irx4 forms an inhibitory complex with the vitamin D and retinoic X
            receptors to regulate cardiac chamber-specific slow MyHC3
            expression
  JOURNAL   J. Biol. Chem. 276 (31), 28835-28841 (2001)
   PUBMED   11382777
REFERENCE   8  (bases 1 to 2229)
  AUTHORS   Bruneau,B.G., Bao,Z.Z., Tanaka,M., Schott,J.J., Izumo,S.,
            Cepko,C.L., Seidman,J.G. and Seidman,C.E.
  TITLE     Cardiac expression of the ventricle-specific homeobox gene Irx4 is
            modulated by Nkx2-5 and dHand
  JOURNAL   Dev. Biol. 217 (2), 266-277 (2000)
   PUBMED   10625552
REFERENCE   9  (bases 1 to 2229)
  AUTHORS   Lewis,M.T., Ross,S., Strickland,P.A., Snyder,C.J. and Daniel,C.W.
  TITLE     Regulated expression patterns of IRX-2, an Iroquois-class homeobox
            gene, in the human breast
  JOURNAL   Cell Tissue Res. 296 (3), 549-554 (1999)
   PUBMED   10370142
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AF124733.1, BC136505.1, BC110912.1 and AI566193.1.
            On Jun 28, 2008 this sequence version replaced gi:7705554.
            
            Transcript Variant: This variant (5) differs in the 5' UTR and
            lacks an alternate internal exon compared to variant 4. It encodes
            isoform b which is shorter than isoform a.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF124733.1, BC110912.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-208               AF124733.1         1-208
            209-1834            BC136505.1         197-1822
            1835-2208           BC110912.1         1723-2096
            2209-2229           AI566193.1         1-21                c
FEATURES             Location/Qualifiers
     source          1..2229
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5p15.3"
     gene            1..2229
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /note="iroquois homeobox 4"
                     /db_xref="GeneID:50805"
                     /db_xref="HGNC:6129"
                     /db_xref="HPRD:09369"
                     /db_xref="MIM:606199"
     exon            1..164
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    24..26
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /note="upstream in-frame stop codon"
     variation       93
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2232372"
     CDS             120..1679
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /note="isoform b is encoded by transcript variant 5;
                     iroquois homeobox protein 4; homeodomain protein IRXA3"
                     /codon_start=1
                     /product="iroquois-class homeodomain protein IRX-4 isoform
                     b"
                     /protein_id="NP_057442.1"
                     /db_xref="GI:7705555"
                     /db_xref="CCDS:CCDS3867.1"
                     /db_xref="GeneID:50805"
                     /db_xref="HGNC:6129"
                     /db_xref="HPRD:09369"
                     /db_xref="MIM:606199"
                     /translation="

MSYPQFGYPYSSAPQFLMATNSLSTCCESGGRTLADSGPAASAQAPVYCPVYESRLLATARHELNSAAALGVYGGPYGGSQGYGNYVTYGSEASAFYSLNSFDSKDGSGSAHGGLAPAAAAYYPYEPALGQYPYDRYGTMDSGTRRKNATRETTSTLKAWLQEHRKNPYPTKGEKIMLAIITKMTLTQVSTWFANARRRLKKENKMTWPPRNKCADEKRPYAEGEEEEGGEEEAREEPLKSSKNAEPVGKEEKELELSDLDDFDPLEAEPPACELKPPFHSLDGGLERVPAAPDGPVKEASGALRMSLAAGGGAALDEDLERARSCLRSAAAGPEPLPGAEGGPQVCEAKLGFVPAGASAGLEAKPRIWSLAHTATAAAAAATSLSQTEFPSCMLKRQGPAAPAAVSSAPATSPSVALPHSGALDRHQDSPVTSLRNWVDGVFHDPILRHSTLNQAWATAKGALLDPGPLGRSLGAGANVLTAPLARAFPPAVPQDAPAAGAARELLALPKAGGKPFCA

"
     misc_feature    552..731
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(552..560,564..566,624..626,642..644,681..683,
                     687..692,699..704,708..716,720..725)
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(552..554,561..563,690..692,699..704,711..713)
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            165..416
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /inference="alignment:Splign:1.39.8"
     variation       209
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2232374"
     exon            417..526
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /inference="alignment:Splign:1.39.8"
     variation       474
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2232376"
     exon            527..855
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /inference="alignment:Splign:1.39.8"
     STS             602..666
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /standard_name="Irx3"
                     /db_xref="UniSTS:498475"
     exon            856..2221
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /inference="alignment:Splign:1.39.8"
     variation       918
                     /gene="IRX4"
                     /gene_synonym="IRXA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3733722"
ORIGIN

tcctgcttcgccctcccagcgcctagaagcctgcagctccggagcagtggccgcgccacgccggccccagcgcgcagaaccctgcaggccccgcccgtccgccccgggccgcgcccgccatgtcctacccgcagtttggatacccctactcctcggctccccagttcttgatggccaccaactccctgagcacgtgctgcgagtccggaggccgcacgctggcggactccgggcccgccgcctcggcccaggcgccggtctactgcccggtctacgagagccggctgctggccaccgcgcgccacgagctcaactcggccgcggcgctgggcgtctatgggggtccctatggcggatcgcagggctatggcaactacgtgacctacggctcggaggcgtccgccttctactcgctgaacagctttgattccaaggatggttcgggatctgcgcatgggggcctggcaccagccgctgccgcctactacccttacgagccagctctgggccagtacccctatgacaggtatggaaccatggacagcggcacgcggcgcaagaacgccacgcgcgagaccaccagcacgctcaaggcctggctgcaggagcaccgcaagaacccctaccccaccaagggcgagaagatcatgctggccatcatcaccaagatgaccctcacacaggtctccacctggttcgccaacgcgcgccggcgcctcaagaaggagaacaagatgacgtggccgccgcggaacaagtgcgcagacgagaagcggccctacgcggagggcgaggaggaggaggggggcgaggaggaggcgcgggaggagcccctcaagagctccaagaacgcagagcccgtgggcaaagaggagaaggagctggagcttagtgacttggacgacttcgacccgctggaagcagagccgccggcgtgcgagctgaagccgcccttccactccctggacggcggtctggagcgcgtccccgccgcgcccgacggcccggtcaaggaggcctcaggcgcgctccggatgtctctggccgcgggtggcggagctgctctggacgaggacctggagagggcccggagctgtctccgcagcgcggcggccgggccggagccactgccgggcgcagagggcggccctcaggtctgcgaggccaagctggggtttgtgccggcgggggcgtcggcaggcctggaggctaagccgcgcatctggtccctggcccacacagccaccgccgccgccgccgccgccacctccctgagccagactgagtttccgtcgtgcatgctcaagcgccaaggtcccgcggcccctgcggctgtgtcctccgcgcccgccacgtccccgtctgtggcccttccccactctggcgccctggacaggcaccaggactccccggtaaccagtctcagaaactgggtggacggggtcttccacgaccccatcctcaggcacagcactttgaaccaggcctgggccaccgccaagggcgccctcctggaccccgggcctctgggacgctcgctgggggcgggcgcgaacgtgctgactgcacccctggcccgcgcctttccgcctgccgtgccccaggacgccccagctgcaggcgccgccagggagctgctcgccctgcccaaggccggcggcaaacccttctgcgcctgaggcgggcgggtcccgagcccaggagggaacccgcgctcaggcggacggcgccgactcttttcactgagtttccagaggaagactagcgcggccaccgcgaagccgccaacccaccggagagggggcttctgaacttggactcctgggaacatggacaagcccggcgctgccacgccggggcctccaccgcctgggcctgagcctgaccgggccattcccaaatttgggacgcggaaggagaggctctcggagcagaagaggccagataccctgaagcataaagtttacgtcaaaagtttacatggagaaggcggttccgttctgaagcgtggtctgctgtcccctgggcgtgaggcctcctgggcctgtcgggcctccgatttcatcctcagcacgtaatgctcaccaacagcacttgcactgagttgactcttgcacactcttgactccataatatgatgctttttaagatgtatgttcacaccaataattgcctgcttcagaggctaatataacaaaaccaataaaaccgagtgatggtgaaaaaaaa

//

Annotations: