LOCUS       NM_007252               2324 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens POU class 6 homeobox 2 (POU6F2), transcript variant 1,
            mRNA.
ACCESSION   NM_007252
VERSION     NM_007252.3  GI:260436856
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2324)
  AUTHORS   Lauc,G., Huffman,J.E., Pucic,M., Zgaga,L., Adamczyk,B., Muzinic,A.,
            Novokmet,M., Polasek,O., Gornik,O., Kristic,J., Keser,T.,
            Vitart,V., Scheijen,B., Uh,H.W., Molokhia,M., Patrick,A.L.,
            McKeigue,P., Kolcic,I., Lukic,I.K., Swann,O., van Leeuwen,F.N.,
            Ruhaak,L.R., Houwing-Duistermaat,J.J., Slagboom,P.E., Beekman,M.,
            de Craen,A.J., Deelder,A.M., Zeng,Q., Wang,W., Hastie,N.D.,
            Gyllensten,U., Wilson,J.F., Wuhrer,M., Wright,A.F., Rudd,P.M.,
            Hayward,C., Aulchenko,Y., Campbell,H. and Rudan,I.
  TITLE     Loci associated with N-glycosylation of human immunoglobulin G show
            pleiotropy with autoimmune diseases and haematological cancers
  JOURNAL   PLoS Genet. 9 (1), E1003225 (2013)
   PUBMED   23382691
REFERENCE   2  (bases 1 to 2324)
  AUTHORS   Anney,R., Klei,L., Pinto,D., Regan,R., Conroy,J., Magalhaes,T.R.,
            Correia,C., Abrahams,B.S., Sykes,N., Pagnamenta,A.T., Almeida,J.,
            Bacchelli,E., Bailey,A.J., Baird,G., Battaglia,A., Berney,T.,
            Bolshakova,N., Bolte,S., Bolton,P.F., Bourgeron,T., Brennan,S.,
            Brian,J., Carson,A.R., Casallo,G., Casey,J., Chu,S.H., Cochrane,L.,
            Corsello,C., Crawford,E.L., Crossett,A., Dawson,G., de Jonge,M.,
            Delorme,R., Drmic,I., Duketis,E., Duque,F., Estes,A., Farrar,P.,
            Fernandez,B.A., Folstein,S.E., Fombonne,E., Freitag,C.M.,
            Gilbert,J., Gillberg,C., Glessner,J.T., Goldberg,J., Green,J.,
            Guter,S.J., Hakonarson,H., Heron,E.A., Hill,M., Holt,R., Howe,J.L.,
            Hughes,G., Hus,V., Igliozzi,R., Kim,C., Klauck,S.M., Kolevzon,A.,
            Korvatska,O., Kustanovich,V., Lajonchere,C.M., Lamb,J.A.,
            Laskawiec,M., Leboyer,M., Le Couteur,A., Leventhal,B.L.,
            Lionel,A.C., Liu,X.Q., Lord,C., Lotspeich,L., Lund,S.C.,
            Maestrini,E., Mahoney,W., Mantoulan,C., Marshall,C.R.,
            McConachie,H., McDougle,C.J., McGrath,J., McMahon,W.M.,
            Melhem,N.M., Merikangas,A., Migita,O., Minshew,N.J., Mirza,G.K.,
            Munson,J., Nelson,S.F., Noakes,C., Noor,A., Nygren,G., Oliveira,G.,
            Papanikolaou,K., Parr,J.R., Parrini,B., Paton,T., Pickles,A.,
            Piven,J., Posey,D.J., Poustka,A., Poustka,F., Prasad,A.,
            Ragoussis,J., Renshaw,K., Rickaby,J., Roberts,W., Roeder,K.,
            Roge,B., Rutter,M.L., Bierut,L.J., Rice,J.P., Salt,J., Sansom,K.,
            Sato,D., Segurado,R., Senman,L., Shah,N., Sheffield,V.C.,
            Soorya,L., Sousa,I., Stoppioni,V., Strawbridge,C., Tancredi,R.,
            Tansey,K., Thiruvahindrapduram,B., Thompson,A.P., Thomson,S.,
            Tryfon,A., Tsiantis,J., Van Engeland,H., Vincent,J.B., Volkmar,F.,
            Wallace,S., Wang,K., Wang,Z., Wassink,T.H., Wing,K., Wittemeyer,K.,
            Wood,S., Yaspan,B.L., Zurawiecki,D., Zwaigenbaum,L., Betancur,C.,
            Buxbaum,J.D., Cantor,R.M., Cook,E.H., Coon,H., Cuccaro,M.L.,
            Gallagher,L., Geschwind,D.H., Gill,M., Haines,J.L., Miller,J.,
            Monaco,A.P., Nurnberger,J.I. Jr., Paterson,A.D.,
            Pericak-Vance,M.A., Schellenberg,G.D., Scherer,S.W.,
            Sutcliffe,J.S., Szatmari,P., Vicente,A.M., Vieland,V.J.,
            Wijsman,E.M., Devlin,B., Ennis,S. and Hallmayer,J.
  TITLE     A genome-wide scan for common alleles affecting risk for autism
  JOURNAL   Hum. Mol. Genet. 19 (20), 4072-4082 (2010)
   PUBMED   20663923
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   3  (bases 1 to 2324)
  AUTHORS   Joslyn,G., Ravindranathan,A., Brush,G., Schuckit,M. and White,R.L.
  TITLE     Human variation in alcohol response is influenced by variation in
            neuronal signaling genes
  JOURNAL   Alcohol. Clin. Exp. Res. 34 (5), 800-812 (2010)
   PUBMED   20201926
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   4  (bases 1 to 2324)
  AUTHORS   Di Renzo,F., Doneda,L., Menegola,E., Sardella,M., De Vecchi,G.,
            Collini,P., Spreafico,F., Fossati-Bellani,F., Giavini,E., Radice,P.
            and Perotti,D.
  TITLE     The murine Pou6f2 gene is temporally and spatially regulated during
            kidney embryogenesis and its human homolog is overexpressed in a
            subset of Wilms tumors
  JOURNAL   J. Pediatr. Hematol. Oncol. 28 (12), 791-797 (2006)
   PUBMED   17164647
REFERENCE   5  (bases 1 to 2324)
  AUTHORS   Perotti,D., Vecchi,G.D., Lualdi,E., Testi,M.A., Sozzi,G.,
            Collini,P., Spreafico,F., Terenziani,M., Fossati-Bellani,F. and
            Radice,P.
  TITLE     Wilms tumor in monozygous twins: clinical, pathological,
            cytogenetic and molecular case report
  JOURNAL   J. Pediatr. Hematol. Oncol. 27 (10), 521-525 (2005)
   PUBMED   16217254
REFERENCE   6  (bases 1 to 2324)
  AUTHORS   Perotti,D., De Vecchi,G., Testi,M.A., Lualdi,E., Modena,P.,
            Mondini,P., Ravagnani,F., Collini,P., Di Renzo,F., Spreafico,F.,
            Terenziani,M., Sozzi,G., Fossati-Bellani,F. and Radice,P.
  TITLE     Germline mutations of the POU6F2 gene in Wilms tumors with loss of
            heterozygosity on chromosome 7p14
  JOURNAL   Hum. Mutat. 24 (5), 400-407 (2004)
   PUBMED   15459955
  REMARK    GeneRIF: observations suggest that POU6F2 is a tumor suppressor and
            is involved in hereditary predisposition to Wilms tumor
REFERENCE   7  (bases 1 to 2324)
  AUTHORS   Perotti,D., Testi,M.A., Mondini,P., Pilotti,S., Green,E.D.,
            Pession,A., Sozzi,G., Pierotti,M.A., Fossati-Bellani,F. and
            Radice,P.
  TITLE     Refinement within single yeast artificial chromosome clones of a
            minimal region commonly deleted on the short arm of chromosome 7 in
            Wilms tumours
  JOURNAL   Genes Chromosomes Cancer 31 (1), 42-47 (2001)
   PUBMED   11284034
REFERENCE   8  (bases 1 to 2324)
  AUTHORS   Phillips,K. and Luisi,B.
  TITLE     The virtuoso of versatility: POU proteins that flex to fit
  JOURNAL   J. Mol. Biol. 302 (5), 1023-1039 (2000)
   PUBMED   11183772
  REMARK    Review article
REFERENCE   9  (bases 1 to 2324)
  AUTHORS   Zhou,H., Yoshioka,T. and Nathans,J.
  TITLE     Retina-derived POU-domain factor-1: a complex POU-domain gene
            implicated in the development of retinal ganglion and amacrine
            cells
  JOURNAL   J. Neurosci. 16 (7), 2261-2274 (1996)
   PUBMED   8601806
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DN991890.1, U91935.1 and
            AC005483.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Oct 3, 2009 this sequence version replaced gi:51873039.
            
            Summary: This gene encodes a member of the POU protein family
            characterized by the presence of a bipartite DNA binding domain,
            consisting of a POU-specific domain and a homeodomain, separated by
            a variable polylinker. The DNA binding domain may bind to DNA as
            monomers or as homo- and/or heterodimers, in a sequence-specific
            manner. The POU family members are transcriptional regulators, many
            of which are known to control cell type-specific differentiation
            pathways. This gene is a tumor suppressor involved in Wilms tumor
            (WT) predisposition. Alternatively spliced transcript variants
            encoding distinct isoforms have been found for this gene.[provided
            by RefSeq, Oct 2009].
            
            Transcript Variant: This variant (1) is the longer transcript and
            encodes the longer isoform (1).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-107               DN991890.1         19-125
            108-732             U91935.1           48-672
            733-1028            AC005483.1         150160-150455       c
            1029-1201           U91935.1           972-1144
            1202-1376           AC005483.1         56892-57066         c
            1377-1714           U91935.1           1320-1657
            1715-2324           AC005483.1         25384-25993         c
FEATURES             Location/Qualifiers
     source          1..2324
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p14.1"
     gene            1..2324
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="POU class 6 homeobox 2"
                     /db_xref="GeneID:11281"
                     /db_xref="HGNC:21694"
                     /db_xref="MIM:609062"
     exon            1..50
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       38
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191832829"
     exon            51..161
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       111
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371792908"
     misc_feature    123..125
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="upstream in-frame stop codon"
     variation       131
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199780108"
     variation       137
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370067576"
     CDS             144..2219
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="isoform 1 is encoded by transcript variant 1; Wilms
                     tumor suppressor locus; POU domain, class 6, transcription
                     factor 2; retina-derived POU-domain factor-1;
                     retina-derived POU domain factor 1"
                     /codon_start=1
                     /product="POU domain, class 6, transcription factor 2
                     isoform 1"
                     /protein_id="NP_009183.3"
                     /db_xref="GI:157743257"
                     /db_xref="CCDS:CCDS34620.2"
                     /db_xref="GeneID:11281"
                     /db_xref="HGNC:21694"
                     /db_xref="MIM:609062"
                     /translation="

MSALLQDPMIAGQVSKPLLSVRSEMNAELRGEDKAATSDSELNEPLLAPVESNDSEDTPSKLFGARGNPALSDPGTPDQHQASQTHPPFPVGPQPLLTAQQLASAVAGVMPGGPPALNQPILIPFNMAGQLGGQQGLVLTLPTANLTNIQGLVAAAAAGGIMTLPLQNLQATSSLNSQLQQLQLQLQQQQQQQQQQPPPSTNQHPQPAPQAPSQSQQQPLQPTPPQQPPPASQQPPAPTSQLQQAPQPQQHQPHSHSQNQNQPSPTQQSSSPPQKPSQSPGHGLPSPLTPPNPLQLVNNPLASQAAAAAAAMSSIASSQAFGNALSSLQGVTGQLVTNAQGQIIGTIPLMPNPGPSSQAASGTQGLQVQPITPQLLTNAQGQIIATVIGNQILPVINTQGITLSPIKPGQQLHQPSQTSVGQAASQGNLLHLAHSQASMSQSPVRQASSSSSSSSSSSALSVGQLVSNPQTAAGEVDGVNLEEIREFAKAFKIRRLSLGLTQTQVGQALSATEGPAYSQSAICRHTILRSHFFLPQEAQENTIASSLTAKLNPGLLYPARFEKLDITPKSAQKIKPVLERWMAEAEARHRAGMQNLTEFIGSEPSKKRKRRTSFTPQALEILNAHFEKNTHPSGQEMTEIAEKLNYDREVVRVWFCNKRQALKNTIKRLKQHEPATAVPLEPLTDSLEENS

"
     misc_feature    1572..1901
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="Pou domain - N-terminal to homeobox domain; Region:
                     Pou; cl02582"
                     /db_xref="CDD:198730"
     misc_feature    1965..2138
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(1965..1979,1983..1985,2034..2036,2052..2054,
                     2091..2093,2097..2102,2109..2114,2118..2126,2130..2135)
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(1971..1973,1980..1982,2100..2102,2109..2114,
                     2121..2123)
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            162..333
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       168
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144817326"
     variation       217
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199673767"
     variation       221
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145866494"
     variation       224
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376754165"
     variation       225
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369976707"
     variation       259
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148998895"
     variation       262
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373529275"
     variation       308
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192309744"
     variation       326
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371496157"
     variation       333
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199858565"
     exon            334..425
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       364
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373840004"
     variation       365
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199994299"
     variation       404
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143669624"
     variation       406
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201880507"
     variation       411
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148094915"
     variation       419
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141204834"
     exon            426..654
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       458
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145078077"
     variation       460
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138865854"
     variation       491
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142566948"
     variation       509
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138654387"
     variation       559
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368561673"
     variation       575
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143731302"
     variation       587
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139491714"
     variation       588
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143406388"
     exon            655..1028
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       671
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147178262"
     variation       699
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140348812"
     variation       706
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201163431"
     variation       707
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201782254"
     variation       716
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:121918261"
     variation       723
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183758448"
     variation       739
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2074936"
     variation       748
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151293651"
     variation       845
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:80127606"
     variation       877
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150071017"
     variation       878
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145403612"
     variation       899..900
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35091229"
     variation       900
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373709968"
     variation       910
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373622114"
     variation       947
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200308619"
     variation       960
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367834526"
     variation       961
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144939808"
     variation       962
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202064223"
     variation       982
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146819544"
     variation       1003
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140579551"
     variation       1012
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201672868"
     variation       1025
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368361923"
     exon            1029..1169
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       1064
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148254024"
     variation       1077
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376654925"
     variation       1079
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141249466"
     variation       1133
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150386704"
     variation       1153
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200602029"
     exon            1170..1376
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       1175
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2302124"
     variation       1202
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2302123"
     variation       1210
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373122380"
     variation       1211
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147128853"
     variation       1226
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368929654"
     variation       1233
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140425700"
     variation       1238
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373309283"
     variation       1277
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149279532"
     variation       1283
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144488464"
     variation       1292
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148571075"
     variation       1317
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376392988"
     variation       1325
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201471567"
     variation       1326
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376245818"
     variation       1340
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2302122"
     variation       1348
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146637189"
     variation       1368
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140161191"
     variation       1370
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143607091"
     variation       1376
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191138577"
     exon            1377..1545
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       1396
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374384343"
     variation       1403
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146778737"
     variation       1426
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75367520"
     variation       1443
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367970454"
     variation       1459
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372113314"
     variation       1463
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375493176"
     variation       1471
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202234462"
     variation       1483
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140486504"
     variation       1495
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368375577"
     variation       1505
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150437987"
     variation       1527
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372667357"
     exon            1546..1714
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       1556
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371316682"
     variation       1578
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375867583"
     variation       1596
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145241880"
     variation       1626
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368700023"
     variation       1641
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:4992268"
     variation       1663
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200235640"
     variation       1684
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369179055"
     variation       1702
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199649027"
     exon            1715..2324
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /inference="alignment:Splign:1.39.8"
     variation       1736
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373469942"
     variation       1764
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201323897"
     variation       1779
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148888580"
     variation       1811
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143525120"
     variation       1869
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201812532"
     variation       1881
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369610763"
     variation       1905
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138208739"
     variation       1931
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200692209"
     variation       1934
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143694290"
     variation       1935
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146116211"
     variation       1955
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373380693"
     variation       1975
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200415799"
     STS             2026..2194
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /standard_name="RH71269"
                     /db_xref="UniSTS:11260"
     variation       2028
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145961110"
     variation       2057
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371560771"
     variation       2058
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7804851"
     variation       2085
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373556433"
     variation       2086
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201519589"
     variation       2094
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377002404"
     variation       2145
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150758284"
     variation       2164
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137959267"
     variation       2169
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149617494"
     variation       2170
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372919598"
     variation       2171
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146111946"
     variation       2207
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140193353"
     variation       2224
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373654083"
     variation       2231
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376847927"
     variation       2258
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367793536"
     variation       2261
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138603140"
     variation       2283..2285
                     /gene="POU6F2"
                     /gene_synonym="RPF-1; WT5; WTSL"
                     /replace=""
                     /replace="aca"
                     /db_xref="dbSNP:201268962"
ORIGIN      

atctctcagcgcagcaggacacggggaccatgcaagctgtaattggtcaggcatgaactctcttgggttgtgttaccctgtttgctgtttactgtcaagatgctgaaagaatgttcttataatgatccaagaggaagtggcaaatgagtgctcttcttcaggatccaatgatagctggacaagtcagtaagcccttgctgtcagtgcggagtgaaatgaatgcggagttgagaggtgaggacaaggctgctacttcagacagcgagctgaatgagcccctgcttgcgcctgtggaatcaaatgacagcgaggacactcccagcaagctcttcggggctagaggaaacccagcattatcagacccaggcactcctgaccaacaccaggccagtcagacccaccccccatttccagttgggccacagccacttctgacggcacagcagttagcttctgctgtggccggcgtgatgccgggaggccccccagccctcaaccagccaatcctcattcccttcaacatggcgggacagctaggaggccagcaaggactggttctcacactgccaacagcgaatctcaccaacatccaagggctggtggcagcagctgcagccggaggcattatgactctgccactgcaaaatctacaagctacctcatccctgaactcccagctccagcagctccagctccagctccagcagcagcagcagcagcagcagcagcagcctcccccgtcaaccaaccagcacccgcaaccagccccacaggcgccctcgcagtcccagcagcagccgctgcagcccaccccaccccagcagccaccacccgcctctcagcagccgccagctcctacatctcagctgcaacaggcgcctcagccccagcagcaccaaccccactcccactcccagaaccagaaccaaccatctccaacccagcagagctccagccccccgcagaaacctagtcagtctccaggacatggcctgccttcaccgctcacgccacccaatcctctacagctggttaataatccactagcaagtcaggctgcagcggctgcagcagccatgagctccatagcaagctcacaggcctttggcaatgccctctccagtcttcagggggtcacaggtcaactagttactaatgcacaaggacagattatcgggaccattccactgatgcctaatccagggccatcgagccaagcagcaagcggcactcagggcttgcaagtgcagccaatcaccccccagctcctcacaaacgcccagggccagatcatcgccacagtcattgggaaccagatcctgcccgtgatcaacacccagggcatcacgctgtcacccatcaagcccggccagcagctccaccaaccctcccagacgtcagtgggtcaagcagcctcccaaggcaaccttctgcacctggctcacagccaagcatccatgtctcaaagtcccgtccggcaggcttcctcttcttcctcctcatcctcctcttcttcagctttgagcgtgggccagttagtcagcaatcctcaaacggcagcgggtgaggtggatggggttaatctggaggagatccgagaatttgccaaagcttttaaaatccggcgcctgtcccttggcctgacccagactcaggtgggacaggctctcagtgctacagagggccccgcgtacagccagtcggccatctgcagacacaccatcctgagaagccactttttcctaccacaggaagcccaagagaacactatagctagcagtctgacagccaaactgaaccctggccttttgtatcctgccaggtttgaaaagctggacatcacccctaaaagtgcccagaagatcaagccggtgcttgagcggtggatggctgaggctgaggcccgccatcgagcaggtatgcagaacctgaccgagtttatcgggagtgaaccatccaaaaagcgcaagcggcgcacctccttcacaccccaggcccttgagatcctcaatgcccactttgagaagaacacacacccttctgggcaggaaatgaccgaaattgctgagaagctgaactatgaccgagaagtagttagagtttggttctgcaataagaggcaagccctgaagaacacaattaaacgcttaaaacagcacgagccggccacggcagtccctttggagcccttaacagactctctggaagaaaactcctaaagagatgcccacccataatcagaagcaaaattcacagaaactaaactccacccttgggactccacaacaacaacaacaacaaaatttaatttaatttaaaaatag

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:11281 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: TAS
            GeneID:11281 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:11281 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: TAS
            GeneID:11281 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:11281 -> Biological process: GO:0007402 [ganglion mother cell fate determination] evidence: TAS
            GeneID:11281 -> Biological process: GO:0007417 [central nervous system development] evidence: TAS
            GeneID:11281 -> Biological process: GO:0007601 [visual perception] evidence: TAS
            GeneID:11281 -> Cellular component: GO:0005634 [nucleus] evidence: IC
            GeneID:11281 -> Cellular component: GO:0005634 [nucleus] evidence: IDA