LOCUS       NM_006902               4071 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens paired related homeobox 1 (PRRX1), transcript variant
            pmx-1a, mRNA.
ACCESSION   NM_006902
VERSION     NM_006902.3  GI:56699461
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4071)
  AUTHORS   Ocana,O.H., Corcoles,R., Fabra,A., Moreno-Bueno,G., Acloque,H.,
            Vega,S., Barrallo-Gimeno,A., Cano,A. and Nieto,M.A.
  TITLE     Metastatic colonization requires the repression of the
            epithelial-mesenchymal transition inducer Prrx1
  JOURNAL   Cancer Cell 22 (6), 709-724 (2012)
   PUBMED   23201163
  REMARK    GeneRIF: The homeobox factor Prrx1 is an EMT inducer conferring
            migratory and invasive properties.
            GeneRIF: We show that the homeobox factor Prrx1 is an EMT inducer
            conferring migratory and invasive properties. The loss of Prrx1 is
            required for cancer cells to metastasize in vivo, which revert to
            the epithelial phenotype concomitant with the acquisition of stem
            cell properties.
REFERENCE   2  (bases 1 to 4071)
  AUTHORS   Turner,S.T., Bailey,K.R., Schwartz,G.L., Chapman,A.B., Chai,H.S.
            and Boerwinkle,E.
  TITLE     Genomic association analysis identifies multiple loci influencing
            antihypertensive response to an angiotensin II receptor blocker
  JOURNAL   Hypertension 59 (6), 1204-1211 (2012)
   PUBMED   22566498
REFERENCE   3  (bases 1 to 4071)
  AUTHORS   Ellinor,P.T., Lunetta,K.L., Albert,C.M., Glazer,N.L., Ritchie,M.D.,
            Smith,A.V., Arking,D.E., Muller-Nurasyid,M., Krijthe,B.P.,
            Lubitz,S.A., Bis,J.C., Chung,M.K., Dorr,M., Ozaki,K., Roberts,J.D.,
            Smith,J.G., Pfeufer,A., Sinner,M.F., Lohman,K., Ding,J.,
            Smith,N.L., Smith,J.D., Rienstra,M., Rice,K.M., Van Wagoner,D.R.,
            Magnani,J.W., Wakili,R., Clauss,S., Rotter,J.I., Steinbeck,G.,
            Launer,L.J., Davies,R.W., Borkovich,M., Harris,T.B., Lin,H.,
            Volker,U., Volzke,H., Milan,D.J., Hofman,A., Boerwinkle,E.,
            Chen,L.Y., Soliman,E.Z., Voight,B.F., Li,G., Chakravarti,A.,
            Kubo,M., Tedrow,U.B., Rose,L.M., Ridker,P.M., Conen,D., Tsunoda,T.,
            Furukawa,T., Sotoodehnia,N., Xu,S., Kamatani,N., Levy,D.,
            Nakamura,Y., Parvez,B., Mahida,S., Furie,K.L., Rosand,J.,
            Muhammad,R., Psaty,B.M., Meitinger,T., Perz,S., Wichmann,H.E.,
            Witteman,J.C., Kao,W.H., Kathiresan,S., Roden,D.M.,
            Uitterlinden,A.G., Rivadeneira,F., McKnight,B., Sjogren,M.,
            Newman,A.B., Liu,Y., Gollob,M.H., Melander,O., Tanaka,T.,
            Stricker,B.H., Felix,S.B., Alonso,A., Darbar,D., Barnard,J.,
            Chasman,D.I., Heckbert,S.R., Benjamin,E.J., Gudnason,V. and Kaab,S.
  TITLE     Meta-analysis identifies six new susceptibility loci for atrial
            fibrillation
  JOURNAL   Nat. Genet. 44 (6), 670-675 (2012)
   PUBMED   22544366
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 4071)
  AUTHORS   Herman,S., Delio,M., Morrow,B. and Samanich,J.
  TITLE     Agnathia-otocephaly complex: a case report and examination of the
            OTX2 and PRRX1 genes
  JOURNAL   Gene 494 (1), 124-129 (2012)
   PUBMED   22198066
  REMARK    GeneRIF: Mutation analysis was performed after sequencing the
            entire coding regions of OTX2 and PRRX1 genes isolated from the
            proband and his parents. After thorough analysis, no DNA variations
            were detected.
REFERENCE   5  (bases 1 to 4071)
  AUTHORS   Liborio,T.N., Acquafreda,T., Matizonkas-Antonio,L.F.,
            Silva-Valenzuela,M.G., Ferraz,A.R. and Nunes,F.D.
  TITLE     In situ hybridization detection of homeobox genes reveals distinct
            expression patterns in oral squamous cell carcinomas
  JOURNAL   Histopathology 58 (2), 225-233 (2011)
   PUBMED   21323949
  REMARK    GeneRIF: HOXA7, PIXT1 and PRRX1 homeobox genes have different
            patterns of expression in oral squamous cell carcinomas depending
            on its histological features.
REFERENCE   6  (bases 1 to 4071)
  AUTHORS   Kataoka,K., Yoshitomo-Nakagawa,K., Shioda,S. and Nishizawa,M.
  TITLE     A set of Hox proteins interact with the Maf oncoprotein to inhibit
            its DNA binding, transactivation, and transforming activities
  JOURNAL   J. Biol. Chem. 276 (1), 819-826 (2001)
   PUBMED   11036080
REFERENCE   7  (bases 1 to 4071)
  AUTHORS   Nakamura,T., Yamazaki,Y., Hatano,Y. and Miura,I.
  TITLE     NUP98 is fused to PMX1 homeobox gene in human acute myelogenous
            leukemia with chromosome translocation t(1;11)(q23;p15)
  JOURNAL   Blood 94 (2), 741-747 (1999)
   PUBMED   10397741
REFERENCE   8  (bases 1 to 4071)
  AUTHORS   Grueneberg,D.A., Henry,R.W., Brauer,A., Novina,C.D., Cheriyath,V.,
            Roy,A.L. and Gilman,M.
  TITLE     A multifunctional DNA-binding protein that promotes the formation
            of serum response factor/homeodomain complexes: identity to TFII-I
  JOURNAL   Genes Dev. 11 (19), 2482-2493 (1997)
   PUBMED   9334314
REFERENCE   9  (bases 1 to 4071)
  AUTHORS   Grueneberg,D.A., Simon,K.J., Brennan,K. and Gilman,M.
  TITLE     Sequence-specific targeting of nuclear signal transduction pathways
            by homeodomain proteins
  JOURNAL   Mol. Cell. Biol. 15 (6), 3318-3326 (1995)
   PUBMED   7760827
REFERENCE   10 (bases 1 to 4071)
  AUTHORS   Grueneberg,D.A., Natesan,S., Alexandre,C. and Gilman,M.Z.
  TITLE     Human and Drosophila homeodomain proteins that enhance the
            DNA-binding activity of serum response factor
  JOURNAL   Science 257 (5073), 1089-1095 (1992)
   PUBMED   1509260
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AA452918.1, BC074993.2,
            AA758879.1 and Z97200.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Dec 17, 2004 this sequence version replaced gi:12707578.
            
            Summary: The DNA-associated protein encoded by this gene is a
            member of the paired family of homeobox proteins localized to the
            nucleus. The protein functions as a transcription co-activator,
            enhancing the DNA-binding activity of serum response factor, a
            protein required for the induction of genes by growth and
            differentiation factors. The protein regulates muscle creatine
            kinase, indicating a role in the establishment of diverse
            mesodermal muscle types. Alternative splicing yields two isoforms
            that differ in abundance and expression patterns. [provided by
            RefSeq, Jul 2008].
            
            Transcript Variant: This variant (pmx-1a) includes an alternate
            exon in the 3' coding region, compared to variant pmx-1b. The
            resulting protein (pmx-1a) has a distinct C-terminus, compared to
            isoform pmx-1b.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK225968.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025081, ERS025083 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-27                AA452918.1         33-59               c
            28-646              BC074993.2         28-646
            647-904             AA758879.1         4-261               c
            905-4071            Z97200.1           40484-43650         c
FEATURES             Location/Qualifiers
     source          1..4071
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q24"
     gene            1..4071
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="paired related homeobox 1"
                     /db_xref="GeneID:5396"
                     /db_xref="HGNC:9142"
                     /db_xref="HPRD:01337"
                     /db_xref="MIM:167420"
     STS             1..901
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /db_xref="UniSTS:482178"
     exon            1..288
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       10
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77911930"
     variation       19
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375142985"
     variation       26
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368044377"
     variation       35
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:79715821"
     CDS             48..701
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="isoform pmx-1a is encoded by transcript variant
                     pmx-1a; homeobox protein PHOX1; paired mesoderm homeo box
                     1; paired mesoderm homeobox protein 1; paired mesoderm
                     homeobox 1 isoform pmx-1b; paired-related homeobox protein
                     1"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 1 isoform
                     pmx-1a"
                     /protein_id="NP_008833.1"
                     /db_xref="GI:5902024"
                     /db_xref="CCDS:CCDS1291.1"
                     /db_xref="GeneID:5396"
                     /db_xref="HGNC:9142"
                     /db_xref="HPRD:01337"
                     /db_xref="MIM:167420"
                     /translation="

MTSSYGHVLERQPALGGRLDSPGNLDTLQAKKNFSVSHLLDLEEAGDMVAAQADENVGEAGRSLLESPGLTSGSDTPQQDNDQLNSEEKKKRKQRRNRTTFNSSQLQALERVFERTHYPDAFVREDLARRVNLTEARVQVWFQNRRAKFRRNERAMLANKNASLLKSYSGDVTAVEQPIVPRPAPRPTDYLSWGTASPYRSSSLPRCCLHEGLHNGF

"
     misc_feature    342..506
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(342..344,348..350,399..401,417..419,456..458,
                     462..467,474..479,483..491,495..500)
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(345..347,465..467,474..479,486..488)
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       62
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138970767"
     variation       83
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377126967"
     variation       85
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200885791"
     variation       96
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370044964"
     variation       122
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199691593"
     STS             138..857
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="Prrx1"
                     /db_xref="UniSTS:525268"
     variation       151
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373448980"
     variation       197
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376351453"
     variation       215
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370202431"
     variation       232
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74674242"
     variation       253
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201153811"
     variation       257
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372174969"
     variation       284
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200693185"
     exon            289..464
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       290
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370699898"
     variation       316
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79567938"
     variation       322
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147354859"
     variation       326
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374406599"
     variation       353
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34501887"
     variation       357
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75715275"
     variation       385
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:387906667"
     variation       401
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200583557"
     variation       455
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377339646"
     exon            465..646
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       513
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147184063"
     variation       519
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149731143"
     variation       550
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201661471"
     variation       560
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374262561"
     variation       570
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201365132"
     variation       612
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372098442"
     exon            647..718
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       653
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375494824"
     variation       677
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148572157"
     variation       692
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184893894"
     variation       693
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148536447"
     variation       702
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146552721"
     variation       712
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372692905"
     exon            719..4071
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /inference="alignment:Splign:1.39.8"
     variation       719
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151333816"
     variation       733
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368848007"
     variation       753
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373373102"
     variation       759
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140550541"
     STS             789..1065
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="G15917"
                     /db_xref="UniSTS:21147"
     variation       843
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201359953"
     variation       868
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139568481"
     variation       880
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371029463"
     variation       893
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200135594"
     variation       950
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6663373"
     variation       1027
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375871578"
     variation       1148
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6666030"
     variation       1215..1216
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tata"
                     /db_xref="dbSNP:10644708"
     variation       1216..1225
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tatatatata"
                     /db_xref="dbSNP:142852183"
     variation       1216..1221
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tatata"
                     /db_xref="dbSNP:112340262"
     variation       1216..1217
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tata"
                     /db_xref="dbSNP:66515062"
     variation       1226..1231
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tatata"
                     /db_xref="dbSNP:72198615"
     variation       1227..1232
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="atatat"
                     /db_xref="dbSNP:66518766"
     variation       1233..1242
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="atatatatat"
                     /db_xref="dbSNP:67734884"
     variation       1234..1235
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="tata"
                     /db_xref="dbSNP:71790118"
     variation       1237..1242
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="atatat"
                     /db_xref="dbSNP:61148079"
     variation       1284
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:180995287"
     variation       1429..1430
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:58473244"
     variation       1622
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144145873"
     variation       1885
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369414337"
     variation       1886
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:41272503"
     STS             1888..2643
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="PRRX1_2266"
                     /db_xref="UniSTS:280930"
     variation       1977
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151019671"
     variation       2083
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186075523"
     variation       2117
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376968825"
     variation       2142
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140894020"
     variation       2165
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188229975"
     variation       2169
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73036701"
     variation       2197
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370208404"
     variation       2211..2212
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35591271"
     variation       2228
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181413858"
     variation       2332
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149709697"
     variation       2333
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377218637"
     variation       2440
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185691611"
     variation       2687
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190652230"
     variation       2717
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3203926"
     variation       2740
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145568344"
     variation       2773
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74123171"
     variation       2778
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2227207"
     variation       2809
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76427450"
     variation       2821
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182885405"
     variation       2960..2961
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34160248"
     variation       2963
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2213750"
     variation       3039
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41272505"
     variation       3069
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11552914"
     variation       3070
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187465183"
     variation       3093
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141178877"
     variation       3120
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115848619"
     variation       3123
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34963551"
     variation       3205
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3820416"
     variation       3207
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183965225"
     variation       3365
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187706632"
     variation       3551
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146969525"
     variation       3637
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114604454"
     variation       3733
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115492463"
     variation       3795
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112446424"
     variation       3806
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143805931"
     variation       3876
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191237385"
     STS             3927..4040
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /standard_name="G31141"
                     /db_xref="UniSTS:18405"
     variation       3979
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182690267"
     variation       4043
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148159513"
     polyA_signal    4049..4054
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
     variation       4059..4061
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:373284840"
     variation       4061
                     /gene="PRRX1"
                     /gene_synonym="AGOTC; PHOX1; PMX1; PRX-1; PRX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3177154"
ORIGIN      

tgattcgagcgggaagaggggggtgggtgggatcggtgggggagaccatgacctccagctacgggcacgttctggagcggcaaccggcgctgggcggccgcttggacagcccgggcaacctcgacaccctgcaggcgaaaaagaacttctccgtcagtcacctgctagacctggaggaagccggggacatggtggcggcacaggcggatgagaacgtgggcgaggctggccggagcctgctggagtcgccgggactcaccagcggcagcgacaccccgcagcaggacaatgaccagctgaactcagaagaaaaaaagaagagaaagcagcgaaggaataggacaaccttcaatagcagccagctgcaggctttggagcgtgtctttgagcggacacactatcctgatgcttttgtgcgagaagaccttgcccgccgggtgaacctcaccgaggcgagagtgcaggtgtggtttcagaaccgaagagccaagttccgcaggaatgagagagccatgctagccaataaaaacgcttccctcctcaaatcctactcaggagacgtgactgctgtggagcagcccatcgtacctcgtcctgctccgagacccaccgattatctctcctgggggacagcgtctccgtacagatcctcgtccctcccaagatgttgtttacacgaggggcttcataacggattctaacggaagacactgaaaagcgccatggctacttattctgccacatgtgccaacaatagccctgcacagggcatcaacatggccaacagcattgccaacctgagactgaaggccaaggaatatagtttacagaggaaccaggtgccaacagtcaactgaggaaaaaaaataattaaacaggcctaagaagaaatcaaaaaccataagacacctatcctgctctgttatttcttcatctgctggggggaaaaagtaaattacaaacaaacaaacaaagcagaactaaaatattgggaccatggcagagaaaagcaggagaggagcaaaatgaaaattagttaacaaatgttcctcctccctctgggataccaccaccacttgtttctgtgtgtgtttattttgtttttctttcattcatgctttgcttaatgtactccaggcttcttcagataggttcagcccacccacccccatgattgtatgaagttttaaaaaaaactacagcagccaaagaaactatatatatatatatatatatatatatccagaatgattgcctctactgtcctcattgacttgtttgaaccttagtgccttaccctgtcctcttcccagttctctttatagaagctctaggagctttcgaaaagccaaagtctttctgaagaatctgtgctggacagacataattccctttctcattgtctccatctttgttggtcatggtaaggtttttccatcagcctctgaaaaaatagttgtgcacaacatctgctcactggactgtctgatccaatgtaattggctgcgtctggctaattctaagcactaaagtctacatctaagctatagatttaagcttgaagctacagattatatcactatcaccaccacccctcaccctatgcaatcaatcaatcaatcatcttaagttaaagatatttgttgtctttgaatgatttgctgtcacagactatttggtagaagaaatatttttcacctgagagaggaagagaaatttctctagtaacacaaagagtgagttctaaaaggcatgcccacatctctttcgtgccttaaggatagtgagatgcacacttatatatatactgtatatatttatatatttatatatatatttcatatatatatataatattgcaagcttaagtttgcaatttcccaaacaatacaaaaagcaaattacacaccctcaccactgttcttatctctatagtgatgaaacattaattagggatcttgctgcttttctttttctacacgaagttttcattaaagccacagaataattgatagggcagctgtttgagaacaggtcccattttcacattagggctttaaatgaattagaaactatttgaggctataaaaatgtccttgagtttggagcctgagctctggtgaaatgctgatacatctgatctatcatgggaattgcagttagagagagtaaggaataccatttagtcatctatccgttcttcacttagcaggaatatgaaagaaaggcacatgtttaagaggaatacctaaaggtttttctaaattccaacatttaaaaggcaattgtgggctatttttattttttaatattttgaaataaagtttagtgtctagggctgggagccaggactgatcttccatttctttttctttgttcccagccatgcttttgtaacttgccaggtggacttgaccaactacattaccatgctgtgcctcagtttacccatttgtaaaatgggattaataatacttacctacctcacaggggtgttgtgaggctctattcatttgctcctttattctttcctgtattctctgtatgtccagcactttgtagccatgggaggaaagggactataaaagtgtacaatgttaatggaatgatacggtacctgaaagccttgttttctagtaagaaaatgctaccttgctgtacatacttataaccttgtatttggaaatgagaaataggtttatattttcagatctctcaaaaatcacatcatttgaccaaagaataatttaagacacatagaacagatttttttaatttatattttcatcctgaccagcttagttctaataatttttagttgtgagtgattaaaaaactttggatcaattttggtcaaacatgccaactttgtagtctgagtgacaggcaaggatttttgggtttaagatgcacttttagcacacatttgtatttcccttggcatatcagattgagctaatggtgatgttatttcaatctaacagccaccaatctgaaattgtatttcaaatgttgattctgtagttctttaaataataatgaagctcatcttatacattttgctttcaccaattgattccttcttcttttagcccactattaaaacatttcttactgaatggttcatgtaggcttgctgaacagcacgcattacttgcttcctgaagagttcccccattcatccatttgtcccattagttgctgtggattatcaagttttgaaggaactgtacatcccaacagactgaaacattctaagtgaaatgagtataatccaagtaactggtgaactttggaggtttggagcttgaagagaatggctaagaagatttgaattatagggagggaacagaaatcatacatgaaaaggttttactgagaaggggaaaaccttagatagagggacatgtgaaacaaaatcatttgaaattttgattcagacatccatttccagtggcaaacagcaaagcctgaacccataaacccaaatgataggtgaagttgggtggttttatccaatgtctcaagcaagcaatgtctgggaatatcatagagtaacaagtgctggtcagccaaagaaacattcactgctggtgaaccaataccataagcatgtattatctaagcacttgatcaagaaatatacatgttgtacaagctctcaattttgttcatttattatcaaatttttaaaatacaagtttggtatgtgatttggaaaagatgccttctggatcttaagccagttgtcagtggaggtcctcagggctgcaaatgtcaagacataaccctgttcctcaccatcatgataccagatacaggtgaatacataggaactatctgcctgtgtcctcaatctcccttcaaacaagatgctgatttgtagggtacttggcaggttaaattaaaccagaagaggtgacttaataaaaaagggaatgacatttagggtataaagatctcataagaaatgtaatatgtaaattatatcttgctttatgttgtaaaatatacattgtttgcgctagaatagaaatgatttcttttcaataaaaagaaagaaggactcta

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5396 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:5396 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS
            GeneID:5396 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:5396 -> Molecular function: GO:0071837 [HMG box domain binding] evidence: IEA
            GeneID:5396 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:5396 -> Biological process: GO:0002053 [positive regulation of mesenchymal cell proliferation] evidence: IEA
            GeneID:5396 -> Biological process: GO:0030326 [embryonic limb morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0042472 [inner ear morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0042474 [middle ear morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0045880 [positive regulation of smoothened signaling pathway] evidence: IEA
            GeneID:5396 -> Biological process: GO:0048701 [embryonic cranial skeleton morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0048844 [artery morphogenesis] evidence: IEA
            GeneID:5396 -> Biological process: GO:0051216 [cartilage development] evidence: IEA
            GeneID:5396 -> Biological process: GO:0060021 [palate development] evidence: IEA
            GeneID:5396 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:5396 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA