LOCUS       NM_006236               1503 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens POU class 3 homeobox 3 (POU3F3), mRNA.
ACCESSION   NM_006236
VERSION     NM_006236.1  GI:5453935
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1503)
  AUTHORS   Niu,N., Schaid,D.J., Abo,R.P., Kalari,K., Fridley,B.L., Feng,Q.,
            Jenkins,G., Batzler,A., Brisbin,A.G., Cunningham,J.M., Li,L.,
            Sun,Z., Yang,P. and Wang,L.
  TITLE     Genetic association with overall survival of taxane-treated lung
            cancer patients - a genome-wide association study in human
            lymphoblastoid cell lines followed by a clinical association study
  JOURNAL   BMC Cancer 12, 422 (2012)
   PUBMED   23006423
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1503)
  AUTHORS   Wissmuller,S., Kosian,T., Wolf,M., Finzsch,M. and Wegner,M.
  TITLE     The high-mobility-group domain of Sox proteins interacts with
            DNA-binding domains of many transcription factors
  JOURNAL   Nucleic Acids Res. 34 (6), 1735-1744 (2006)
   PUBMED   16582099
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1503)
  AUTHORS   Kuhlbrodt,K., Herbarth,B., Sock,E., Enderich,J.,
            Hermans-Borgmeyer,I. and Wegner,M.
  TITLE     Cooperative function of POU proteins and SOX proteins in glial
            cells
  JOURNAL   J. Biol. Chem. 273 (26), 16050-16057 (1998)
   PUBMED   9632656
REFERENCE   4  (bases 1 to 1503)
  AUTHORS   Sumiyama,K., Washio-Watanabe,K., Ono,T., Yoshida,M.C., Hayakawa,T.
            and Ueda,S.
  TITLE     Human class III POU genes, POU3F1 and POU3F3, map to chromosomes
            1p34.1 and 3p14.2
  JOURNAL   Mamm. Genome 9 (2), 180-181 (1998)
   PUBMED   9457692
REFERENCE   5  (bases 1 to 1503)
  AUTHORS   Malik,K.F., Jaffe,H., Brady,J. and Young,W.S. III.
  TITLE     The class III POU factor Brn-4 interacts with other class III POU
            factors and the heterogeneous nuclear ribonucleoprotein U
  JOURNAL   Brain Res. Mol. Brain Res. 45 (1), 99-107 (1997)
   PUBMED   9105675
REFERENCE   6  (bases 1 to 1503)
  AUTHORS   Sumiyama,K., Washio-Watanabe,K., Saitou,N., Hayakawa,T. and Ueda,S.
  TITLE     Class III POU genes: generation of homopolymeric amino acid repeats
            under GC pressure in mammals
  JOURNAL   J. Mol. Evol. 43 (3), 170-178 (1996)
   PUBMED   8703082
REFERENCE   7  (bases 1 to 1503)
  AUTHORS   He,X., Treacy,M.N., Simmons,D.M., Ingraham,H.A., Swanson,L.W. and
            Rosenfeld,M.G.
  TITLE     Expression of a large family of POU-domain regulatory genes in
            mammalian brain development
  JOURNAL   Nature 340 (6228), 35-41 (1989)
   PUBMED   2739723
  REMARK    Erratum:[Nature 1989 Aug 24;340(6235):662]
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB001835.1.
            
            Summary: POU3F3 is a member of the class III POU family of
            transcription factors (see POU3F1; MIM 602479) that are expressed
            in the central nervous system. The POU domain in these proteins is
            required for high affinity binding to octamer DNA sequences
            (summarized by Sumiyama et al., 1996 [PubMed 8703082]).[supplied by
            OMIM, Jul 2010].
FEATURES             Location/Qualifiers
     source          1..1503
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q12.1"
     gene            1..1503
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /note="POU class 3 homeobox 3"
                     /db_xref="GeneID:5455"
                     /db_xref="HGNC:9216"
                     /db_xref="HPRD:03922"
                     /db_xref="MIM:602480"
     CDS             1..1503
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /note="OTF-8; brn-1; oct-8; brain-1; octamer-binding
                     protein 8; octamer-binding transcription factor 8;
                     brain-specific homeobox/POU domain protein 1"
                     /codon_start=1
                     /product="POU domain, class 3, transcription factor 3"
                     /protein_id="NP_006227.1"
                     /db_xref="GI:5453936"
                     /db_xref="CCDS:CCDS33265.1"
                     /db_xref="GeneID:5455"
                     /db_xref="HGNC:9216"
                     /db_xref="HPRD:03922"
                     /db_xref="MIM:602480"
                     /translation="

MATAASNPYLPGNSLLAAGSIVHSDAAGAGGGGGGGGGGGGGGAGGGGGGMQPGSAAVTSGAYRGDPSSVKMVQSDFMQGAMAASNGGHMLSHAHQWVTALPHAAAAAAAAAAAAVEASSPWSGSAVGMAGSPQQPPQPPPPPPQGPDVKGGAGRDDLHAGTALHHRGPPHLGPPPPPPHQGHPGGWGAAAAAAAAAAAAAAAAHLPSMAGGQQPPPQSLLYSQPGGFTVNGMLSAPPGPGGGGGGAGGGAQSLVHPGLVRGDTPELAEHHHHHHHHAHPHPPHPHHAQGPPHHGGGGGGAGPGLNSHDPHSDEDTPTSDDLEQFAKQFKQRRIKLGFTQADVGLALGTLYGNVFSQTTICRFEALQLSFKNMCKLKPLLNKWLEEADSSTGSPTSIDKIAAQGRKRKKRTSIEVSVKGALESHFLKCPKPSAQEITNLADSLQLEKEVVRVWFCNRRQKEKRMTPPGIQQQTPDDVYSQVGTVSADTPPPHHGLQTSVQ

"
     misc_feature    940..1164
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /note="Found in Pit-Oct-Unc transcription factors; Region:
                     POU; smart00352"
                     /db_xref="CDD:197673"
     misc_feature    1219..1392
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(1219..1233,1237..1239,1288..1290,1306..1308,
                     1345..1347,1351..1356,1363..1368,1372..1380,1384..1389)
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(1225..1227,1234..1236,1354..1356,1363..1368,
                     1375..1377)
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            1..1503
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /inference="alignment:Splign:1.39.8"
     STS             1..1503
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /db_xref="UniSTS:481875"
     variation       87
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186512421"
     variation       200
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375481587"
     variation       360
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191591917"
     variation       774
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368850481"
     variation       894
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372442573"
     variation       972
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182992623"
     variation       996
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377053693"
     variation       1062
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371621473"
     variation       1173
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199565525"
     variation       1179
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140419524"
     variation       1187
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146486201"
     variation       1200
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143105467"
     variation       1206
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140129722"
     variation       1215
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:137877846"
     variation       1221
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372764445"
     variation       1275
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377188135"
     variation       1347
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147315122"
     variation       1430
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377514724"
     variation       1473
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202016096"
     variation       1485
                     /gene="POU3F3"
                     /gene_synonym="BRN1; OTF8"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374340255"
ORIGIN      

atggccacggcggcttctaacccctacctgccggggaacagcctgctcgcggccggctctattgtgcactcggacgcggcaggggctggcggcggcgggggtggcggcggcggcggcggcgggggcggcgcagggggcgggggcggcggcatgcagccgggcagcgccgccgtgacctcgggcgcctaccggggggacccgtcctctgtcaagatggtccagagcgacttcatgcagggggccatggccgccagcaacggcggccatatgctgagccacgcgcaccagtgggtcacagccctgccccacgccgccgccgccgccgccgctgccgccgccgccgccgtggaggcgagctcgccgtggtcgggcagcgccgtgggcatggctggcagcccccagcagccaccgcagccgccgccgccaccgccgcagggccccgacgtgaagggcggcgccgggcgcgacgacctgcacgcgggcacagcgctgcaccaccgcgggccgccgcacctcggacccccgccgccgcccccacaccagggccaccctgggggctggggggcggccgccgctgccgcagccgcagccgccgccgccgccgccgccgcgcacctcccgtccatggccgggggccagcagccgccgccgcagagtctgctctactcgcagcccggaggcttcacggtgaacggcatgctgagcgcgccaccggggcccggcggcggcggcggcggcgcgggcggtggagcccagagcttggtgcacccggggctggtgcgcggggacacgccagagctggccgagcaccaccaccaccaccaccaccacgcgcatcctcacccgccgcacccgcaccacgcgcagggacccccgcaccacggcggcggcggcggcggcgcggggcctggactcaacagccacgacccgcactcggacgaggacacgccgacgtcggacgacctggagcagttcgccaagcagttcaagcagcggcgcatcaagctgggcttcacgcaggccgacgtggggttggcgctgggcacactctacggcaacgtgttctcgcagaccaccatctgccgcttcgaggccctgcagctgagcttcaagaacatgtgcaagctcaagccgctgctgaacaagtggctggaggaggcggactcaagcaccggcagccccacaagcatcgacaagatcgcggcgcagggccgcaagcgcaagaagcggacctctatcgaggtgagcgtcaagggcgcgctggagagccacttcctcaagtgccccaagccctccgcgcaggagatcaccaacctggccgacagcctgcagctcgagaaggaggtggtgcgggtctggttctgcaatcggcgccaaaaggagaagcgcatgacgccgcccgggatccaacagcagacgcccgacgacgtctactcgcaggtgggcaccgtgagcgccgacacgccgccgcctcaccacgggctgcagacgagcgttcagtga

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:5455 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:5455 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: ISS
            GeneID:5455 -> Molecular function: GO:0071837 [HMG box domain binding] evidence: IEA
            GeneID:5455 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:5455 -> Biological process: GO:0007417 [central nervous system development] evidence: TAS
            GeneID:5455 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: ISS
            GeneID:5455 -> Biological process: GO:0010628 [positive regulation of gene expression] evidence: ISS
            GeneID:5455 -> Biological process: GO:0021799 [cerebral cortex radially oriented cell migration] evidence: IEA
            GeneID:5455 -> Biological process: GO:0021869 [forebrain ventricular zone progenitor cell division] evidence: IEA
            GeneID:5455 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: ISS
            GeneID:5455 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: ISS
            GeneID:5455 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: ISS
            GeneID:5455 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:5455 -> Biological process: GO:0072218 [metanephric ascending thin limb development] evidence: ISS
            GeneID:5455 -> Biological process: GO:0072227 [metanephric macula densa development] evidence: ISS
            GeneID:5455 -> Biological process: GO:0072233 [metanephric thick ascending limb development] evidence: ISS
            GeneID:5455 -> Biological process: GO:0072236 [metanephric loop of Henle development] evidence: ISS
            GeneID:5455 -> Biological process: GO:0072240 [metanephric DCT cell differentiation] evidence: ISS
            GeneID:5455 -> Cellular component: GO:0005634 [nucleus] evidence: ISS