2025-06-16 18:10:08, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_005814 2793 bp mRNA linear PRI 02-JUN-2013 DEFINITION Homo sapiens glycoprotein A33 (transmembrane) (GPA33), mRNA. ACCESSION NM_005814 VERSION NM_005814.1 GI:5031560 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2793) AUTHORS Infante,J.R., Bendell,J.C., Goff,L.W., Jones,S.F., Chan,E., Sudo,T., Burris,H.A. and Berlin,J.D. TITLE Safety, pharmacokinetics and pharmacodynamics of the anti-A33 fully-human monoclonal antibody, KRN330, in patients with advanced colorectal cancer JOURNAL Eur. J. Cancer 49 (6), 1169-1175 (2013) PUBMED 23294608 REMARK GeneRIF: Data indicate positive staining was observed for both A33 expression and KRN330 binding from patients biopsied on Day 8, 9 or 14 following initial dosing of 3 mg/kg. REFERENCE 2 (bases 1 to 2793) AUTHORS Chan,W.M. and Ward,B.M. TITLE Increased interaction between vaccinia virus proteins A33 and B5 is detrimental to infectious extracellular enveloped virion production JOURNAL J. Virol. 86 (15), 8232-8244 (2012) PUBMED 22623782 REMARK GeneRIF: Increased interaction between vaccinia virus proteins A33 and B5 is detrimental to infectious extracellular enveloped virion production. REFERENCE 3 (bases 1 to 2793) AUTHORS Chan,W.M. and Ward,B.M. TITLE The A33-dependent incorporation of B5 into extracellular enveloped vaccinia virions is mediated through an interaction between their lumenal domains JOURNAL J. Virol. 86 (15), 8210-8220 (2012) PUBMED 22623777 REMARK GeneRIF: The A33-dependent incorporation of B5 into extracellular enveloped vaccinia virions is mediated through an interaction between their lumenal domains. REFERENCE 4 (bases 1 to 2793) AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A. TITLE Follow-up of a major linkage peak on chromosome 1 reveals suggestive QTLs associated with essential hypertension: GenNet study JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009) PUBMED 19536175 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 2793) AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H., Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W. TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible genetic association with bone mineral density variation JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009) PUBMED 19064610 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 6 (bases 1 to 2793) AUTHORS Mao,Z., Song,S., Zhu,Y., Yi,X., Zhang,H., Shang,Y. and Tong,T. TITLE Transcriptional regulation of A33 antigen expression by gut-enriched Kruppel-like factor JOURNAL Oncogene 22 (28), 4434-4443 (2003) PUBMED 12853980 REMARK GeneRIF: Regulation of A33 antigen expression by GKLF. REFERENCE 7 (bases 1 to 2793) AUTHORS Johnstone,C.N., White,S.J., Tebbutt,N.C., Clay,F.J., Ernst,M., Biggs,W.H., Viars,C.S., Czekay,S., Arden,K.C. and Heath,J.K. TITLE Analysis of the regulation of the A33 antigen gene reveals intestine-specific mechanisms of gene expression JOURNAL J. Biol. Chem. 277 (37), 34531-34539 (2002) PUBMED 12114523 REMARK GeneRIF: cloning, chromosomal localizations, exon-intron structures and transcription start sites - target gene for the intestine-specific homeobox transcription factor, CDX1. REFERENCE 8 (bases 1 to 2793) AUTHORS Moritz,R.L., Ritter,G., Catimel,B., Cohen,L.S., Welt,S., Old,L.J., Burgess,A.W., Nice,E.C. and Simpson,R.J. TITLE Micro-sequencing strategies for the human A33 antigen, a novel surface glycoprotein of human gastrointestinal epithelium JOURNAL J Chromatogr A 798 (1-2), 91-101 (1998) PUBMED 9542130 REFERENCE 9 (bases 1 to 2793) AUTHORS Ritter,G., Cohen,L.S., Nice,E.C., Catimel,B., Burgess,A.W., Moritz,R.L., Ji,H., Heath,J.K., White,S.J., Welt,S., Old,L.J. and Simpson,R.J. TITLE Characterization of posttranslational modifications of human A33 antigen, a novel palmitoylated surface glycoprotein of human gastrointestinal epithelium JOURNAL Biochem. Biophys. Res. Commun. 236 (3), 682-686 (1997) PUBMED 9245713 REFERENCE 10 (bases 1 to 2793) AUTHORS Heath,J.K., White,S.J., Johnstone,C.N., Catimel,B., Simpson,R.J., Moritz,R.L., Tu,G.F., Ji,H., Whitehead,R.H., Groenen,L.C., Scott,A.M., Ritter,G., Cohen,L., Welt,S., Old,L.J., Nice,E.C. and Burgess,A.W. TITLE The human A33 antigen is a transmembrane glycoprotein and a novel member of the immunoglobulin superfamily JOURNAL Proc. Natl. Acad. Sci. U.S.A. 94 (2), 469-474 (1997) PUBMED 9012807 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U79725.1. Summary: The glycoprotein encoded by this gene is a cell surface antigen that is expressed in greater than 95% of human colon cancers. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. The sequence of the extracellular region contains 2 domains characteristic of the CD2 subgroup of the immunoglobulin (Ig) superfamily. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U79725.1, BC107165.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025094, ERS025098 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. FEATURES Location/Qualifiers source 1..2793 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q24.1" gene 1..2793 /gene="GPA33" /gene_synonym="A33" /note="glycoprotein A33 (transmembrane)" /db_xref="GeneID:10223" /db_xref="HGNC:4445" /db_xref="HPRD:03704" /db_xref="MIM:602171" exon 1..387 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" variation 36 /gene="GPA33" /gene_synonym="A33" /replace="c" /replace="t" /db_xref="dbSNP:2281960" variation 39 /gene="GPA33" /gene_synonym="A33" /replace="c" /replace="t" /db_xref="dbSNP:2281961" variation 109 /gene="GPA33" /gene_synonym="A33" /replace="c" /replace="t" /db_xref="dbSNP:2281962" misc_feature 192..194 /gene="GPA33" /gene_synonym="A33" /note="upstream in-frame stop codon" STS 273..1379 /gene="GPA33" /gene_synonym="A33" /db_xref="UniSTS:481386" variation 294 /gene="GPA33" /gene_synonym="A33" /replace="a" /replace="c" /db_xref="dbSNP:28384507" STS 323..1347 /gene="GPA33" /gene_synonym="A33" /db_xref="UniSTS:481998" CDS 345..1304 /gene="GPA33" /gene_synonym="A33" /note="cell surface A33 antigen; transmembrane glycoprotein A33" /codon_start=1 /product="cell surface A33 antigen precursor" /protein_id="NP_005805.1" /db_xref="GI:5031561" /db_xref="CCDS:CCDS1258.1" /db_xref="GeneID:10223" /db_xref="HGNC:4445" /db_xref="HPRD:03704" /db_xref="MIM:602171" /translation="
MVGKMWPVLWTLCAVRVTVDAISVETPQDVLRASQGKSVTLPCTYHTSTSSREGLIQWDKLLLTHTERVVIWPFSNKNYIHGELYKNRVSISNNAEQSDASITIDQLTMADNGTYECSVSLMSDLEGNTKSRVRLLVLVPPSKPECGIEGETIIGNNIQLTCQSKEGSPTPQYSWKRYNILNQEQPLAQPASGQPVSLKNISTDTSGYYICTSSNEEGTQFCNITVAVRSPSMNVALYVGIAVGVVAALIIIGIIIYCCCCRGKDDNTEDKEDARPNREAYEEPPEQLRELSREREEEDDYRQEEQRSTGRESPDHLDQ
" sig_peptide 345..407 /gene="GPA33" /gene_synonym="A33" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 405..746 /gene="GPA33" /gene_synonym="A33" /note="Immunoglobulin V-set domain; Region: V-set; pfam07686" /db_xref="CDD:203725" mat_peptide 408..1301 /gene="GPA33" /gene_synonym="A33" /product="cell surface A33 antigen" /note="A33 antigen" misc_feature 447..731 /gene="GPA33" /gene_synonym="A33" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:213125" misc_feature 810..998 /gene="GPA33" /gene_synonym="A33" /note="Immunoglobulin C-2 Type; Region: IGc2; smart00408" /db_xref="CDD:197706" misc_feature 1050..1112 /gene="GPA33" /gene_synonym="A33" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q99795.1); transmembrane region" exon 388..542 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" variation 402 /gene="GPA33" /gene_synonym="A33" /replace="a" /replace="g" /db_xref="dbSNP:2274531" exon 543..759 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" exon 760..915 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" variation 839 /gene="GPA33" /gene_synonym="A33" /replace="g" /replace="t" /db_xref="dbSNP:2228399" exon 916..1035 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" exon 1036..1171 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" exon 1172..2793 /gene="GPA33" /gene_synonym="A33" /inference="alignment:Splign:1.39.8" STS 1389..1531 /gene="GPA33" /gene_synonym="A33" /standard_name="RH103589" /db_xref="UniSTS:97914" variation 2494 /gene="GPA33" /gene_synonym="A33" /replace="c" /replace="t" /db_xref="dbSNP:12461" STS 2538..2651 /gene="GPA33" /gene_synonym="A33" /standard_name="SHGC-53101" /db_xref="UniSTS:46908" variation 2613 /gene="GPA33" /gene_synonym="A33" /replace="a" /replace="c" /db_xref="dbSNP:11736" polyA_signal 2777..2782 /gene="GPA33" /gene_synonym="A33" ORIGIN
ctacccctttgtgagcagtctaggactttgtacacctgttaagtagggagaaggcaggggaggtggctggtttaaggggaacttgagggaagtagggaagactcctcttgggacctttggagtaggtgacacatgagcccagccccagctcacctgccaatccagctgaggagctcacctgccaatccagctgaggctgggcagaggtgggtgagaagagggaaaattgcagggacctccagttgggccaggccagaagctgctgtagctttaaccagacagctcagacctgtctggaggctgccagtgacaggttaggtttagggcagagaagaagcaagaccatggtggggaagatgtggcctgtgttgtggacactctgtgcagtcagggtgaccgtcgatgccatctctgtggaaactccgcaggacgttcttcgggcttcgcagggaaagagtgtcaccctgccctgcacctaccacacttccacctccagtcgagagggacttattcaatgggataagctcctcctcactcatacggaaagggtggtcatctggccgttttcaaacaaaaactacatccatggtgagctttataagaatcgcgtcagcatatccaacaatgctgagcagtccgatgcctccatcaccattgatcagctgaccatggctgacaacggcacctacgagtgttctgtctcgctgatgtcagacctggagggcaacaccaagtcacgtgtccgcctgttggtcctcgtgccaccctccaaaccagaatgcggcatcgagggagagaccataattgggaacaacatccagctgacctgccaatcaaaggagggctcaccaacccctcagtacagctggaagaggtacaacatcctgaatcaggagcagcccctggcccagccagcctcaggtcagcctgtctccctgaagaatatctccacagacacatcgggttactacatctgtacctccagcaatgaggaggggacgcagttctgcaacatcacggtggccgtcagatctccctccatgaacgtggccctgtatgtgggcatcgcggtgggcgtggttgcagccctcattatcattggcatcatcatctactgctgctgctgccgagggaaggacgacaacactgaagacaaggaggatgcaaggccgaaccgggaagcctatgaggagccaccagagcagctaagagaactttccagagagagggaggaggaggatgactacaggcaagaagagcagaggagcactgggcgtgaatccccggaccacctcgaccagtgacaggccagcagcagagggcggcggaggaagggttaggggttcattctcccgcttcctggcctcccttctcctttctaagccctgttctcctgtccctccatcccagacattgatggggacatttcttccccagtgtcagctgtggggaacatggctggcctggtaagggggtccctgtgctgatcctgctgacctcactgtcctgtgaagtaacccctcctggctgtgacacctggtgcgggcctggccctcactcaagaccaggctgcagcctccacttccctcgtagttggcaggagctcctggaagcacagcgctgagcatggggcgctcccactcagaactctccagggaggcgatgccagccttggggggtgggggctgtcctgctcacctgtgtgcccagcacctggaggggcaccaggtggagggtttgcactccacacatctttcttgaatgaatgaaagaataagtgagtatgcttgggccctgcattggcctggcctccagctcccactccctttccaacctcacttcccgtagctgccagtatgttccaaaccctcctgggaaggccacctcccactcctgctgcacaggccctggggagcttttgcccacacactttccatctctgcctgtcaatatcgtacctgtccctccaggcccatctcaaatcacaaggatttctctaaccctatcctaattgtccacatacgtggaaacaatcctgttactctgtcccacgtccaatcatgggccacaaggcacagtcttctgagcgagtgctctcactgtattagagcgccagctccttggggcagggcctgggcctcatggcttttgctttccctgaagccctagtagctggcgcccatcctagtgggcacttaagcttaattggggaaactgctttgattggttgtgccttcccttctctggtctccttgagatgatcgtagacacagggatgattcccacccaaacccacgtattcattcagtgagttaaacacgaattgatttaaagtgaacacacacaagggagcttgcttgcagatggtctgagttcttgtgtcctggtaattcctctccaggccagaataattggcatgtctcctcaacccacatggggttcctggttgttcctgcatcccgatacctcagccctggccctgcccagcccatttgggctctggttttctggtggggctgtcctgctgccctcccacagcctccttctgtttgtcgagcatttcttctactcttgagagctcaggcagcgttagggctgcttaggtctcatggaccagtggctggtctcacccaactgcagtttactattgctatcttttctggatgatcagaaaaataattccataaatctattgtctacttgcgattttttaaaaaatgtatatttttatatatattgttaaatcctttgcttcattccaaatgctttcagtaataataaaattgtgggtgg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:10223 -> Molecular function: GO:0004872 [receptor activity] evidence: TAS GeneID:10223 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.