GGRNA Home | Help | Advanced search

2025-06-16 18:10:08, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_005814               2793 bp    mRNA    linear   PRI 02-JUN-2013
DEFINITION  Homo sapiens glycoprotein A33 (transmembrane) (GPA33), mRNA.
ACCESSION   NM_005814
VERSION     NM_005814.1  GI:5031560
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2793)
  AUTHORS   Infante,J.R., Bendell,J.C., Goff,L.W., Jones,S.F., Chan,E.,
            Sudo,T., Burris,H.A. and Berlin,J.D.
  TITLE     Safety, pharmacokinetics and pharmacodynamics of the anti-A33
            fully-human monoclonal antibody, KRN330, in patients with advanced
            colorectal cancer
  JOURNAL   Eur. J. Cancer 49 (6), 1169-1175 (2013)
   PUBMED   23294608
  REMARK    GeneRIF: Data indicate positive staining was observed for both A33
            expression and KRN330 binding from patients biopsied on Day 8, 9 or
            14 following initial dosing of 3 mg/kg.
REFERENCE   2  (bases 1 to 2793)
  AUTHORS   Chan,W.M. and Ward,B.M.
  TITLE     Increased interaction between vaccinia virus proteins A33 and B5 is
            detrimental to infectious extracellular enveloped virion production
  JOURNAL   J. Virol. 86 (15), 8232-8244 (2012)
   PUBMED   22623782
  REMARK    GeneRIF: Increased interaction between vaccinia virus proteins A33
            and B5 is detrimental to infectious extracellular enveloped virion
            production.
REFERENCE   3  (bases 1 to 2793)
  AUTHORS   Chan,W.M. and Ward,B.M.
  TITLE     The A33-dependent incorporation of B5 into extracellular enveloped
            vaccinia virions is mediated through an interaction between their
            lumenal domains
  JOURNAL   J. Virol. 86 (15), 8210-8220 (2012)
   PUBMED   22623777
  REMARK    GeneRIF: The A33-dependent incorporation of B5 into extracellular
            enveloped vaccinia virions is mediated through an interaction
            between their lumenal domains.
REFERENCE   4  (bases 1 to 2793)
  AUTHORS   Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
  TITLE     Follow-up of a major linkage peak on chromosome 1 reveals
            suggestive QTLs associated with essential hypertension: GenNet
            study
  JOURNAL   Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
   PUBMED   19536175
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 2793)
  AUTHORS   Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
            Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
  TITLE     Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
            genetic association with bone mineral density variation
  JOURNAL   Hum. Mol. Genet. 18 (4), 679-687 (2009)
   PUBMED   19064610
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   6  (bases 1 to 2793)
  AUTHORS   Mao,Z., Song,S., Zhu,Y., Yi,X., Zhang,H., Shang,Y. and Tong,T.
  TITLE     Transcriptional regulation of A33 antigen expression by
            gut-enriched Kruppel-like factor
  JOURNAL   Oncogene 22 (28), 4434-4443 (2003)
   PUBMED   12853980
  REMARK    GeneRIF: Regulation of A33 antigen expression by GKLF.
REFERENCE   7  (bases 1 to 2793)
  AUTHORS   Johnstone,C.N., White,S.J., Tebbutt,N.C., Clay,F.J., Ernst,M.,
            Biggs,W.H., Viars,C.S., Czekay,S., Arden,K.C. and Heath,J.K.
  TITLE     Analysis of the regulation of the A33 antigen gene reveals
            intestine-specific mechanisms of gene expression
  JOURNAL   J. Biol. Chem. 277 (37), 34531-34539 (2002)
   PUBMED   12114523
  REMARK    GeneRIF: cloning, chromosomal localizations, exon-intron structures
            and transcription start sites - target gene for the
            intestine-specific homeobox transcription factor, CDX1.
REFERENCE   8  (bases 1 to 2793)
  AUTHORS   Moritz,R.L., Ritter,G., Catimel,B., Cohen,L.S., Welt,S., Old,L.J.,
            Burgess,A.W., Nice,E.C. and Simpson,R.J.
  TITLE     Micro-sequencing strategies for the human A33 antigen, a novel
            surface glycoprotein of human gastrointestinal epithelium
  JOURNAL   J Chromatogr A 798 (1-2), 91-101 (1998)
   PUBMED   9542130
REFERENCE   9  (bases 1 to 2793)
  AUTHORS   Ritter,G., Cohen,L.S., Nice,E.C., Catimel,B., Burgess,A.W.,
            Moritz,R.L., Ji,H., Heath,J.K., White,S.J., Welt,S., Old,L.J. and
            Simpson,R.J.
  TITLE     Characterization of posttranslational modifications of human A33
            antigen, a novel palmitoylated surface glycoprotein of human
            gastrointestinal epithelium
  JOURNAL   Biochem. Biophys. Res. Commun. 236 (3), 682-686 (1997)
   PUBMED   9245713
REFERENCE   10 (bases 1 to 2793)
  AUTHORS   Heath,J.K., White,S.J., Johnstone,C.N., Catimel,B., Simpson,R.J.,
            Moritz,R.L., Tu,G.F., Ji,H., Whitehead,R.H., Groenen,L.C.,
            Scott,A.M., Ritter,G., Cohen,L., Welt,S., Old,L.J., Nice,E.C. and
            Burgess,A.W.
  TITLE     The human A33 antigen is a transmembrane glycoprotein and a novel
            member of the immunoglobulin superfamily
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 94 (2), 469-474 (1997)
   PUBMED   9012807
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from U79725.1.
            
            Summary: The glycoprotein encoded by this gene is a cell surface
            antigen that is expressed in greater than 95% of human colon
            cancers. The open reading frame encodes a 319-amino acid
            polypeptide having a putative secretory signal sequence and 3
            potential glycosylation sites. The predicted mature protein has a
            213-amino acid extracellular region, a single transmembrane domain,
            and a 62-amino acid intracellular tail. The sequence of the
            extracellular region contains 2 domains characteristic of the CD2
            subgroup of the immunoglobulin (Ig) superfamily. [provided by
            RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U79725.1, BC107165.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025094, ERS025098 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..2793
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q24.1"
     gene            1..2793
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /note="glycoprotein A33 (transmembrane)"
                     /db_xref="GeneID:10223"
                     /db_xref="HGNC:4445"
                     /db_xref="HPRD:03704"
                     /db_xref="MIM:602171"
     exon            1..387
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     variation       36
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2281960"
     variation       39
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2281961"
     variation       109
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2281962"
     misc_feature    192..194
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /note="upstream in-frame stop codon"
     STS             273..1379
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /db_xref="UniSTS:481386"
     variation       294
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:28384507"
     STS             323..1347
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /db_xref="UniSTS:481998"
     CDS             345..1304
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /note="cell surface A33 antigen; transmembrane
                     glycoprotein A33"
                     /codon_start=1
                     /product="cell surface A33 antigen precursor"
                     /protein_id="NP_005805.1"
                     /db_xref="GI:5031561"
                     /db_xref="CCDS:CCDS1258.1"
                     /db_xref="GeneID:10223"
                     /db_xref="HGNC:4445"
                     /db_xref="HPRD:03704"
                     /db_xref="MIM:602171"
                     /translation="
MVGKMWPVLWTLCAVRVTVDAISVETPQDVLRASQGKSVTLPCTYHTSTSSREGLIQWDKLLLTHTERVVIWPFSNKNYIHGELYKNRVSISNNAEQSDASITIDQLTMADNGTYECSVSLMSDLEGNTKSRVRLLVLVPPSKPECGIEGETIIGNNIQLTCQSKEGSPTPQYSWKRYNILNQEQPLAQPASGQPVSLKNISTDTSGYYICTSSNEEGTQFCNITVAVRSPSMNVALYVGIAVGVVAALIIIGIIIYCCCCRGKDDNTEDKEDARPNREAYEEPPEQLRELSREREEEDDYRQEEQRSTGRESPDHLDQ
"
     sig_peptide     345..407
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    405..746
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /note="Immunoglobulin V-set domain; Region: V-set;
                     pfam07686"
                     /db_xref="CDD:203725"
     mat_peptide     408..1301
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /product="cell surface A33 antigen"
                     /note="A33 antigen"
     misc_feature    447..731
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    810..998
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /note="Immunoglobulin C-2 Type; Region: IGc2; smart00408"
                     /db_xref="CDD:197706"
     misc_feature    1050..1112
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q99795.1);
                     transmembrane region"
     exon            388..542
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     variation       402
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2274531"
     exon            543..759
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     exon            760..915
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     variation       839
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2228399"
     exon            916..1035
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     exon            1036..1171
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     exon            1172..2793
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /inference="alignment:Splign:1.39.8"
     STS             1389..1531
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /standard_name="RH103589"
                     /db_xref="UniSTS:97914"
     variation       2494
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12461"
     STS             2538..2651
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /standard_name="SHGC-53101"
                     /db_xref="UniSTS:46908"
     variation       2613
                     /gene="GPA33"
                     /gene_synonym="A33"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11736"
     polyA_signal    2777..2782
                     /gene="GPA33"
                     /gene_synonym="A33"
ORIGIN      
ctacccctttgtgagcagtctaggactttgtacacctgttaagtagggagaaggcaggggaggtggctggtttaaggggaacttgagggaagtagggaagactcctcttgggacctttggagtaggtgacacatgagcccagccccagctcacctgccaatccagctgaggagctcacctgccaatccagctgaggctgggcagaggtgggtgagaagagggaaaattgcagggacctccagttgggccaggccagaagctgctgtagctttaaccagacagctcagacctgtctggaggctgccagtgacaggttaggtttagggcagagaagaagcaagaccatggtggggaagatgtggcctgtgttgtggacactctgtgcagtcagggtgaccgtcgatgccatctctgtggaaactccgcaggacgttcttcgggcttcgcagggaaagagtgtcaccctgccctgcacctaccacacttccacctccagtcgagagggacttattcaatgggataagctcctcctcactcatacggaaagggtggtcatctggccgttttcaaacaaaaactacatccatggtgagctttataagaatcgcgtcagcatatccaacaatgctgagcagtccgatgcctccatcaccattgatcagctgaccatggctgacaacggcacctacgagtgttctgtctcgctgatgtcagacctggagggcaacaccaagtcacgtgtccgcctgttggtcctcgtgccaccctccaaaccagaatgcggcatcgagggagagaccataattgggaacaacatccagctgacctgccaatcaaaggagggctcaccaacccctcagtacagctggaagaggtacaacatcctgaatcaggagcagcccctggcccagccagcctcaggtcagcctgtctccctgaagaatatctccacagacacatcgggttactacatctgtacctccagcaatgaggaggggacgcagttctgcaacatcacggtggccgtcagatctccctccatgaacgtggccctgtatgtgggcatcgcggtgggcgtggttgcagccctcattatcattggcatcatcatctactgctgctgctgccgagggaaggacgacaacactgaagacaaggaggatgcaaggccgaaccgggaagcctatgaggagccaccagagcagctaagagaactttccagagagagggaggaggaggatgactacaggcaagaagagcagaggagcactgggcgtgaatccccggaccacctcgaccagtgacaggccagcagcagagggcggcggaggaagggttaggggttcattctcccgcttcctggcctcccttctcctttctaagccctgttctcctgtccctccatcccagacattgatggggacatttcttccccagtgtcagctgtggggaacatggctggcctggtaagggggtccctgtgctgatcctgctgacctcactgtcctgtgaagtaacccctcctggctgtgacacctggtgcgggcctggccctcactcaagaccaggctgcagcctccacttccctcgtagttggcaggagctcctggaagcacagcgctgagcatggggcgctcccactcagaactctccagggaggcgatgccagccttggggggtgggggctgtcctgctcacctgtgtgcccagcacctggaggggcaccaggtggagggtttgcactccacacatctttcttgaatgaatgaaagaataagtgagtatgcttgggccctgcattggcctggcctccagctcccactccctttccaacctcacttcccgtagctgccagtatgttccaaaccctcctgggaaggccacctcccactcctgctgcacaggccctggggagcttttgcccacacactttccatctctgcctgtcaatatcgtacctgtccctccaggcccatctcaaatcacaaggatttctctaaccctatcctaattgtccacatacgtggaaacaatcctgttactctgtcccacgtccaatcatgggccacaaggcacagtcttctgagcgagtgctctcactgtattagagcgccagctccttggggcagggcctgggcctcatggcttttgctttccctgaagccctagtagctggcgcccatcctagtgggcacttaagcttaattggggaaactgctttgattggttgtgccttcccttctctggtctccttgagatgatcgtagacacagggatgattcccacccaaacccacgtattcattcagtgagttaaacacgaattgatttaaagtgaacacacacaagggagcttgcttgcagatggtctgagttcttgtgtcctggtaattcctctccaggccagaataattggcatgtctcctcaacccacatggggttcctggttgttcctgcatcccgatacctcagccctggccctgcccagcccatttgggctctggttttctggtggggctgtcctgctgccctcccacagcctccttctgtttgtcgagcatttcttctactcttgagagctcaggcagcgttagggctgcttaggtctcatggaccagtggctggtctcacccaactgcagtttactattgctatcttttctggatgatcagaaaaataattccataaatctattgtctacttgcgattttttaaaaaatgtatatttttatatatattgttaaatcctttgcttcattccaaatgctttcagtaataataaaattgtgggtgg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10223 -> Molecular function: GO:0004872 [receptor activity] evidence: TAS
            GeneID:10223 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.