Home |
Help |
Advanced search
2025-05-09 20:05:20, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001913 3039 bp mRNA linear PRI 12-MAY-2013 DEFINITION Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 2, mRNA. ACCESSION NM_001913 VERSION NM_001913.3 GI:321400109 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3039) AUTHORS Li,T., Wang,H., Sun,Y., Zhao,L., Gang,Y., Guo,X., Huang,R., Yang,Z., Pan,Y., Wu,K., Xu,L., Liu,Z. and Fan,D. TITLE Transcription factor CUTL1 is a negative regulator of drug resistance in gastric cancer JOURNAL J. Biol. Chem. 288 (6), 4135-4147 (2013) PUBMED 23255599 REMARK GeneRIF: overexpression of active CUTL1 significantly resulted in increased cancer tissue response to chemotherapy and therefore inhibited growth, whereas knockdown of CUTL1 conferred resistance to chemotherapy. REFERENCE 2 (bases 1 to 3039) AUTHORS McNerney,M.E., Brown,C.D., Wang,X., Bartom,E.T., Karmakar,S., Bandlamudi,C., Yu,S., Ko,J., Sandall,B.P., Stricker,T., Anastasi,J., Grossman,R.L., Cunningham,J.M., Le Beau,M.M. and White,K.P. TITLE CUX1 is a haploinsufficient tumor suppressor gene on chromosome 7 frequently inactivated in acute myeloid leukemia JOURNAL Blood 121 (6), 975-983 (2013) PUBMED 23212519 REMARK GeneRIF: Data indicate CUX1 as a conserved, haploinsufficient tumor suppressor frequently deleted in myeloid neoplasms. REFERENCE 3 (bases 1 to 3039) AUTHORS Liu,K.C., Lin,B.S., Zhao,M., Wang,K.Y. and Lan,X.P. TITLE Cutl1: a potential target for cancer therapy JOURNAL Cell. Signal. 25 (1), 349-354 (2013) PUBMED 23085261 REMARK GeneRIF: Cutl1 played transcriptional level mediated by signal transduction, translational level mediated by miR122, posttranslational level such as phosphorylation, de-phosphorylation, acetylation and proteolytic cleavage. Review article REFERENCE 4 (bases 1 to 3039) AUTHORS Sasayama,D., Hiraishi,A., Tatsumi,M., Kamijima,K., Ikeda,M., Umene-Nakano,W., Yoshimura,R., Nakamura,J., Iwata,N. and Kunugi,H. TITLE Possible association of CUX1 gene polymorphisms with antidepressant response in major depressive disorder JOURNAL Pharmacogenomics J. (2012) In press PUBMED 22584459 REMARK Publication Status: Available-Online prior to print REFERENCE 5 (bases 1 to 3039) AUTHORS Zhai,Z., Ha,N., Papagiannouli,F., Hamacher-Brady,A., Brady,N., Sorge,S., Bezdan,D. and Lohmann,I. TITLE Antagonistic regulation of apoptosis and differentiation by the Cut transcription factor represents a tumor-suppressing mechanism in Drosophila JOURNAL PLoS Genet. 8 (3), E1002582 (2012) PUBMED 22438831 REMARK GeneRIF: we find repression of apoptosis regulators by Cux1 in human cancer cells. REFERENCE 6 (bases 1 to 3039) AUTHORS Lievens,P.M., Tufarelli,C., Donady,J.J., Stagg,A. and Neufeld,E.J. TITLE CASP, a novel, highly conserved alternative-splicing product of the CDP/cut/cux gene, lacks cut-repeat and homeo DNA-binding domains, and interacts with full-length CDP in vitro JOURNAL Gene 197 (1-2), 73-81 (1997) PUBMED 9332351 REFERENCE 7 (bases 1 to 3039) AUTHORS Chernousov,M.A., Stahl,R.C. and Carey,D.J. TITLE Schwann cells secrete a novel collagen-like adhesive protein that binds N-syndecan JOURNAL J. Biol. Chem. 271 (23), 13844-13853 (1996) PUBMED 8662884 REFERENCE 8 (bases 1 to 3039) AUTHORS Scherer,S.W., Neufeld,E.J., Lievens,P.M., Orkin,S.H., Kim,J. and Tsui,L.C. TITLE Regional localization of the CCAAT displacement protein gene (CUTL1) to 7q22 by analysis of somatic cell hybrids JOURNAL Genomics 15 (3), 695-696 (1993) PUBMED 8468066 REFERENCE 9 (bases 1 to 3039) AUTHORS Neufeld,E.J., Skalnik,D.G., Lievens,P.M. and Orkin,S.H. TITLE Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut JOURNAL Nat. Genet. 1 (1), 50-55 (1992) PUBMED 1301999 REFERENCE 10 (bases 1 to 3039) AUTHORS Ottolenghi,S., Mantovani,R., Nicolis,S., Ronchi,A. and Giglioni,B. TITLE DNA sequences regulating human globin gene transcription in nondeletional hereditary persistence of fetal hemoglobin JOURNAL Hemoglobin 13 (6), 523-541 (1989) PUBMED 2481658 REMARK Review article COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC410774.1, AK222832.1, L12579.1 and BC012323.1. This sequence is a reference standard in the RefSeqGene project. On Feb 4, 2011 this sequence version replaced gi:31652235. Summary: The protein encoded by this gene is a member of the homeodomain family of DNA binding proteins. It may regulate gene expression, morphogenesis, and differentiation and it may also play a role in the cell cycle progession. Several alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Feb 2011]. Transcript Variant: This variant (2) has an alternate 3' sequence including the coding region, as compared to variant 4. The resulting isoform (b) has a shorter and distinct C-terminus, as compared to isoform d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: L12579.1, AK222832.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025083, ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-104 DC410774.1 1-104 105-1392 AK222832.1 1-1288 1393-2095 L12579.1 1285-1987 2096-3039 BC012323.1 1983-2926 FEATURES Location/Qualifiers source 1..3039 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q22.1" gene 1..3039 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="cut-like homeobox 1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="HPRD:00295" /db_xref="MIM:116896" exon 1..190 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" misc_feature 74..76 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="upstream in-frame stop codon" variation 80 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:373949747" variation 97 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:368174106" variation 101 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:371287227" variation 110 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:373609751" CDS 128..2164 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="isoform b is encoded by transcript variant 2; golgi integral membrane protein 6; protein CASP; cut homolog; putative protein product of Nbla10317; homeobox protein cux-1; CCAAT displacement protein" /codon_start=1 /product="protein CASP isoform b" /protein_id="NP_001904.2" /db_xref="GI:31652236" /db_xref="CCDS:CCDS5720.1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="HPRD:00295" /db_xref="MIM:116896" /translation="
MAANVGSMFQYWKRFDLQQLQRELDATATVLANRQDESEQSRKRLIEQSREFKKNTPEDLRKQVAPLLKSFQGEIDALSKRSKEAEAAFLNVYKRLIDVPDPVPALDLGQQLQLKVQRLHDIETENQKLRETLEEYNKEFAEVKNQEVTIKALKEKIREYEQTLKNQAETIALEKEQKLQNDFAEKERKLQETQMSTTSKLEEAEHKVQSLQTALEKTRTELFDLKTKYDEETTAKADEIEMIMTDLERANQRAEVAQREAETLREQLSSANHSLQLASQIQKAPDVEQAIEVLTRSSLEVELAAKEREIAQLVEDVQRLQASLTKLRENSASQISQLEQQLSAKNSTLKQLEEKLKGQADYEEVKKELNILKSMEFAPSEGAGTQDAAKPLEVLLLEKNRSLQSENAALRISNSDLSGRCAELQVRITEAVATATEQRELIARLEQDLSIIQSIQRPDAEGAAEHRLEKIPEPIKEATALFYGPAAPASGALPEGQVDSLLSIISSQRERFRARNQELEAENRLAQHTLQALQSELDSLRADNIKLFEKIKFLQSYPGRGSGSDDTELRYSSQYEERLDPFSSFSKRERQRKYLSLSPWDKATLSMGRLVLSNKMARTIGFFYTLFLHCLVFLVLYKLAWSESMERDCATFCAKKFADHLHKFHENDNGAAAGDLWQ
"
misc_feature 1124..1126
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1388..2068
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/note="CASP C terminal; Region: CASP_C; pfam08172"
/db_xref="CDD:203868"
misc_feature 1985..2047
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13948.2);
transmembrane region"
variation 152
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:200925347"
exon 191..301
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 193
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:140709702"
variation 208
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:376836450"
variation 223
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150487622"
variation 258
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:200309302"
variation 265
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:145317607"
variation 294
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:149191757"
exon 302..349
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 321
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:143267032"
variation 322
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:374397164"
exon 350..428
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 408
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:367586602"
variation 422
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:148322402"
exon 429..566
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 498
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:201537465"
variation 501
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:77240477"
variation 554
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:371126154"
exon 567..690
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 574
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:143157780"
variation 589
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:201650660"
variation 631
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:375357960"
variation 632
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:138328289"
variation 637
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:11540900"
variation 644
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199800281"
exon 691..767
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 701
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:142863665"
variation 703
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:201993734"
variation 748
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:199535463"
variation 758
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:150799140"
exon 768..834
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 773
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:75508780"
variation 783
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:187519642"
variation 800
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:139126094"
variation 814
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:149507748"
exon 835..883
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 861
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:372003626"
exon 884..988
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 895
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:377269248"
variation 931
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:370842930"
variation 933
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:189334175"
variation 937
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:180828525"
STS 938..1040
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="D12S1228E"
/db_xref="UniSTS:151475"
variation 942
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:139855321"
variation 985
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:143307709"
exon 989..1177
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 998
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:200126349"
variation 1022
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:372334618"
variation 1039
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:139114802"
variation 1049
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:376319241"
variation 1076
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:142950109"
variation 1095
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:369666651"
variation 1101
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:367848953"
variation 1120
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:151118398"
variation 1157
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:201709857"
variation 1171
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:374020928"
exon 1178..1236
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
exon 1237..1285
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1263
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141118279"
variation 1264
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:11540899"
exon 1286..1382
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1291
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:147937477"
variation 1333
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:369005585"
variation 1353
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:374021528"
variation 1354
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:367577378"
variation 1358
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:371301313"
exon 1383..1510
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1392
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:62001055"
variation 1393
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:813000"
variation 1407
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:372464298"
variation 1427
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:114381819"
variation 1431
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:139906438"
variation 1435
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:149786604"
variation 1448
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:371828253"
variation 1453
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:200271633"
variation 1457
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:145765083"
variation 1458
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:375278390"
variation 1507
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:370845468"
exon 1511..1577
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1517
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:803064"
variation 1518
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:368235304"
variation 1526
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:144199298"
variation 1527
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:146554363"
variation 1557
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:199558313"
variation 1563
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:140386892"
exon 1578..1690
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1597
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199776060"
variation 1598
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150976222"
variation 1603
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:140831161"
variation 1612
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:371715592"
variation 1628
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:375776301"
variation 1665
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150151598"
variation 1680
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:2230102"
variation 1690
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199822336"
exon 1691..1807
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1700
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:138450169"
variation 1705
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:369806479"
variation 1721
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="g"
/replace="t"
/db_xref="dbSNP:142767232"
variation 1753
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:146927122"
variation 1760
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2230103"
variation 1763
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:118010189"
variation 1786
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:373393100"
variation 1805
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:144393643"
variation 1806
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:148760130"
exon 1808..1891
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1814
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:187131238"
variation 1827
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:370290068"
variation 1828
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:375513246"
variation 1835
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141515782"
variation 1836
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:202149844"
variation 1842
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:150890071"
variation 1852
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:111537304"
variation 1853
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:139293638"
variation 1858
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:144329021"
variation 1859
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:146049827"
variation 1889
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:371285615"
variation 1890
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:140034854"
exon 1892..1948
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1902
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293839"
variation 1936
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:372229678"
exon 1949..2029
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 1953
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:144124584"
variation 1979
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:372479780"
STS 1980..2064
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="MARC_4357-4358:991938494:5"
/db_xref="UniSTS:231083"
variation 1980
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:145083539"
variation 1988
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:201615556"
exon 2030..2094
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 2039
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:367747037"
variation 2044
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:149124693"
variation 2053
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:200899513"
variation 2054
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:142155041"
variation 2056
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:151204833"
exon 2095..3032
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/inference="alignment:Splign:1.39.8"
variation 2098
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141196267"
variation 2099
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:376508181"
variation 2122
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:200345816"
variation 2123
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="g"
/db_xref="dbSNP:377645698"
variation 2135
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:369144524"
variation 2149
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:112505360"
variation 2160..2161
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace=""
/replace="g"
/db_xref="dbSNP:146386435"
variation 2182
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:199575958"
variation 2183
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:373876353"
variation 2189
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:909128"
variation 2193
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:201628239"
variation 2194
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:377408845"
variation 2200
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:374386627"
variation 2220
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:1296069"
variation 2277
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:151048012"
variation 2303
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:141097964"
variation 2337
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:150278456"
variation 2375
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:2734615"
variation 2383
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:185803208"
variation 2396
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:75580662"
variation 2414
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:191591974"
variation 2442
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:41275221"
variation 2511
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:182997186"
variation 2570
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:113634317"
variation 2571
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:188776036"
variation 2599
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/db_xref="dbSNP:147926104"
variation 2674
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:77369840"
STS 2768..3030
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="WI-21075"
/db_xref="UniSTS:50237"
variation 2769
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:192033664"
STS 2874..3031
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/standard_name="RH44454"
/db_xref="UniSTS:53362"
variation 2881
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:8950"
variation 2890
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:1056363"
variation 2891
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:141716299"
variation 2907
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:182766749"
variation 2913
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="t"
/db_xref="dbSNP:75104200"
variation 2942
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="a"
/replace="c"
/db_xref="dbSNP:1056386"
variation 2968
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:9691899"
polyA_signal 3012..3017
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
variation 3030
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
/replace="c"
/replace="t"
/db_xref="dbSNP:73187873"
polyA_site 3032
/gene="CUX1"
/gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1;
CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200;
p75"
ORIGIN
ctcggtggcggcggcggcggccggctccaggccgggttttggcgccgcccgcctgctgcctcctggcggctcctgaactccagccccctctctatcagccgctcactccgtctcaatatgtctcaagatggcggccaatgtgggatcgatgtttcaatattggaagcgctttgatttacagcagctgcagagagaactcgatgccaccgcaacggtattggcgaaccggcaggatgaaagtgagcagtccagaaagcggcttatcgaacagagccgggagttcaagaagaacactccagaggatttgcgcaagcaggtagcgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagcaaggaagctgaagcagctttcttgaatgtctacaaaagattgattgacgtcccagatcccgtaccagctttggatctcggacagcaactccagctcaaagtgcagcgcctgcacgatattgaaacagagaaccagaaacttagggaaactctggaagaatacaacaaggaatttgctgaagtgaaaaatcaagaggttacgataaaagcacttaaagagaaaatccgagaatatgaacagacactgaagaaccaagccgaaaccatagctcttgagaaggaacagaagttacagaatgactttgcagaaaaggagagaaagctgcaggagacacagatgtccaccacctcaaagctggaggaagctgagcataaggttcagagcctacaaacagccctggaaaaaactcgaacagaattatttgacctgaaaaccaaatacgatgaagaaactactgcaaaggccgacgagattgaaatgatcatgacggaccttgaaagggcaaaccagagggcagaggtggctcagagagaggcggagaccttaagggaacagctctcatcggccaatcactccctccagctggcctcacagatccagaaggcaccagacgtggagcaggccatagaggtgctgacccgctccagcctagaagttgagttggccgccaaggagcgggagatcgcacagctggtggaggacgtgcagagactccaggccagcctcaccaagctgcgggagaattcggccagccagatctcacagcttgagcagcagctgagcgccaaaaacagcacactcaaacaactggaagaaaaactcaaaggccaggctgactatgaagaggtgaagaaagagctgaacattctgaagtccatggagtttgcaccgtccgagggcgctgggacacaggatgcggccaagcccctggaggtgctgttgctggagaagaaccgctcgctgcagtccgagaacgccgcgctgcgcatctccaacagcgacctgagcggacgctgtgcagagctgcaagtccgtatcactgaggctgtggccacagccactgagcagagagagctgatcgcccgcctggagcaggacctgagcatcattcagtccatccagcggcccgatgccgagggtgccgctgagcaccgcctggagaagatcccagagcccatcaaagaggccactgccctattctacggacctgcagcaccagccagcggtgccctcccagagggccaggtggattcactgctttccatcatctccagccagagggagcgcttccgtgcccggaaccaggagcttgaggccgagaaccgcctggcccagcacaccctccaggccctgcagagtgagctggacagcctgcgcgccgacaacatcaagctctttgagaagatcaagttcctgcagagctaccctggccggggcagcggcagtgatgacacggagctgcggtactcgtcccagtacgaggagcgcctggaccccttctcctccttcagcaagcgggagcggcagaggaagtacctgagcttgagtccctgggacaaggccaccctcagcatggggcgtctggttctctccaacaagatggcgcgcaccatcggcttcttctacacactgttcctgcactgcctggtcttcctggtgctctacaagctggcatggagcgagagcatggagagggactgtgccaccttctgcgccaagaagttcgctgaccacctgcacaagttccacgagaatgacaacggggctgcggctggtgacttgtggcagtgataccccggggcctcccccgtgacagtgacggctgcgcctccaccccgactgctcagtgcatctaatcacttagactcccctgaagaatcccccatggaaactgcccttatccgctgtccagcagctgccagaggccccaggtcacctcgggtccccttgaaagaatgtctcggtcacatcaggcccgctaggtccagagagcgagcccccaatgcccggccaggctaagccgcagagaccctctcagcccccacctcaggttagggctctgcccgcagcctgacctctagccctggtggcagaggtccctcagctgcgaggctaattgggtgaccaccgattccagctgcggttaatccagcttgggcctgtctgcactgcgatcctcttgggctctcctaggatccccccatgccccgtaagaggtggaagacgcttccttccaggacagcaggctttgagtccagcacccccagcctgcctttgccaccagccccaccctgcagagtatatgaggcttgacagagtctgccccctcccccactgcaccccaagagagagagccccagccagcggaacagtttctattaccccctccctgcccccagacccatgtgatttctgctttcttctttagcaagatattctggtttctagataaggaagagtctctaatgagcccccgagccccagtctcttcagactcatggattggtctgaggggtctgaacgtctcctagccaatcagaactggctgtggaccaccctagcacggccacctctcagggccactggcaggccttcctgagttagatttgtagttgcatatttagctttgcacatttgaaataaaccacggttgcagccaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:1523 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
GeneID:1523 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:1523 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IEA
GeneID:1523 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:1523 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA
GeneID:1523 -> Biological process: GO:0000301 [retrograde transport, vesicle recycling within Golgi] evidence: IEA
GeneID:1523 -> Biological process: GO:0001822 [kidney development] evidence: IEA
GeneID:1523 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:1523 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:1523 -> Biological process: GO:0006891 [intra-Golgi vesicle-mediated transport] evidence: IEA
GeneID:1523 -> Biological process: GO:0007275 [multicellular organismal development] evidence: TAS
GeneID:1523 -> Biological process: GO:0030324 [lung development] evidence: IEA
GeneID:1523 -> Biological process: GO:0042491 [auditory receptor cell differentiation] evidence: IEA
GeneID:1523 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
GeneID:1523 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:1523 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:1523 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:1523 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:1523 -> Cellular component: GO:0030173 [integral to Golgi membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.