GGRNA Home | Help | Advanced search

2025-05-09 19:26:44, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001485               1335 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens gastrulation brain homeobox 2 (GBX2), mRNA.
ACCESSION   NM_001485
VERSION     NM_001485.2  GI:45593143
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1335)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   2  (bases 1 to 1335)
  AUTHORS   Heimbucher,T., Murko,C., Bajoghli,B., Aghaallaei,N., Huber,A.,
            Stebegg,R., Eberhard,D., Fink,M., Simeone,A. and Czerny,T.
  TITLE     Gbx2 and Otx2 interact with the WD40 domain of Groucho/Tle
            corepressors
  JOURNAL   Mol. Cell. Biol. 27 (1), 340-351 (2007)
   PUBMED   17060451
  REMARK    GeneRIF: Gbx2 and Otx2 interact with the WD40 domain of Groucho/Tle
            corepressors
REFERENCE   3  (bases 1 to 1335)
  AUTHORS   Glinsky,G.V., Berezovska,O. and Glinskii,A.B.
  TITLE     Microarray analysis identifies a death-from-cancer signature
            predicting therapy failure in patients with multiple types of
            cancer
  JOURNAL   J. Clin. Invest. 115 (6), 1503-1521 (2005)
   PUBMED   15931389
  REMARK    GeneRIF: Altered expression is associated with therapy failure and
            death in patients with multiple types of cancer.
REFERENCE   4  (bases 1 to 1335)
  AUTHORS   Hillier,L.W., Graves,T.A., Fulton,R.S., Fulton,L.A., Pepin,K.H.,
            Minx,P., Wagner-McPherson,C., Layman,D., Wylie,K., Sekhon,M.,
            Becker,M.C., Fewell,G.A., Delehaunty,K.D., Miner,T.L., Nash,W.E.,
            Kremitzki,C., Oddy,L., Du,H., Sun,H., Bradshaw-Cordum,H., Ali,J.,
            Carter,J., Cordes,M., Harris,A., Isak,A., van Brunt,A., Nguyen,C.,
            Du,F., Courtney,L., Kalicki,J., Ozersky,P., Abbott,S.,
            Armstrong,J., Belter,E.A., Caruso,L., Cedroni,M., Cotton,M.,
            Davidson,T., Desai,A., Elliott,G., Erb,T., Fronick,C., Gaige,T.,
            Haakenson,W., Haglund,K., Holmes,A., Harkins,R., Kim,K.,
            Kruchowski,S.S., Strong,C.M., Grewal,N., Goyea,E., Hou,S., Levy,A.,
            Martinka,S., Mead,K., McLellan,M.D., Meyer,R., Randall-Maher,J.,
            Tomlinson,C., Dauphin-Kohlberg,S., Kozlowicz-Reilly,A., Shah,N.,
            Swearengen-Shahid,S., Snider,J., Strong,J.T., Thompson,J.,
            Yoakum,M., Leonard,S., Pearman,C., Trani,L., Radionenko,M.,
            Waligorski,J.E., Wang,C., Rock,S.M., Tin-Wollam,A.M., Maupin,R.,
            Latreille,P., Wendl,M.C., Yang,S.P., Pohl,C., Wallis,J.W.,
            Spieth,J., Bieri,T.A., Berkowicz,N., Nelson,J.O., Osborne,J.,
            Ding,L., Meyer,R., Sabo,A., Shotland,Y., Sinha,P., Wohldmann,P.E.,
            Cook,L.L., Hickenbotham,M.T., Eldred,J., Williams,D., Jones,T.A.,
            She,X., Ciccarelli,F.D., Izaurralde,E., Taylor,J., Schmutz,J.,
            Myers,R.M., Cox,D.R., Huang,X., McPherson,J.D., Mardis,E.R.,
            Clifton,S.W., Warren,W.C., Chinwalla,A.T., Eddy,S.R., Marra,M.A.,
            Ovcharenko,I., Furey,T.S., Miller,W., Eichler,E.E., Bork,P.,
            Suyama,M., Torrents,D., Waterston,R.H. and Wilson,R.K.
  TITLE     Generation and annotation of the DNA sequences of human chromosomes
            2 and 4
  JOURNAL   Nature 434 (7034), 724-731 (2005)
   PUBMED   15815621
REFERENCE   5  (bases 1 to 1335)
  AUTHORS   Gao,A.C., Lou,W. and Isaacs,J.T.
  TITLE     Enhanced GBX2 expression stimulates growth of human prostate cancer
            cells via transcriptional up-regulation of the interleukin 6 gene
  JOURNAL   Clin. Cancer Res. 6 (2), 493-497 (2000)
   PUBMED   10690529
REFERENCE   6  (bases 1 to 1335)
  AUTHORS   Gao,A.C., Lou,W. and Isaacs,J.T.
  TITLE     Down-regulation of homeobox gene GBX2 expression inhibits human
            prostate cancer clonogenic ability and tumorigenicity
  JOURNAL   Cancer Res. 58 (7), 1391-1394 (1998)
   PUBMED   9537237
REFERENCE   7  (bases 1 to 1335)
  AUTHORS   Kowenz-Leutz,E., Herr,P., Niss,K. and Leutz,A.
  TITLE     The homeobox gene GBX2, a target of the myb oncogene, mediates
            autocrine growth and monocyte differentiation
  JOURNAL   Cell 91 (2), 185-195 (1997)
   PUBMED   9346236
REFERENCE   8  (bases 1 to 1335)
  AUTHORS   Lin,X., Swaroop,A., Vaccarino,F.M., Murtha,M.T., Haas,M., Ji,X.,
            Ruddle,F.H. and Leckman,J.F.
  TITLE     Characterization and sequence analysis of the human
            homeobox-containing gene GBX2
  JOURNAL   Genomics 31 (3), 335-342 (1996)
   PUBMED   8838315
REFERENCE   9  (bases 1 to 1335)
  AUTHORS   Matsui,T., Hirai,M., Hirano,M. and Kurosawa,Y.
  TITLE     The HOX complex neighbored by the EVX gene, as well as two other
            homeobox-containing genes, the GBX-class and the EN-class, are
            located on the same chromosomes 2 and 7 in humans
  JOURNAL   FEBS Lett. 336 (1), 107-110 (1993)
   PUBMED   7903253
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AF118452.1 and BF115559.1.
            On Mar 19, 2004 this sequence version replaced gi:4503940.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC137449.1, DR760752.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1147              AF118452.1         1-1147
            1148-1335           BF115559.1         1-188               c
FEATURES             Location/Qualifiers
     source          1..1335
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q37.2"
     gene            1..1335
                     /gene="GBX2"
                     /note="gastrulation brain homeobox 2"
                     /db_xref="GeneID:2637"
                     /db_xref="HGNC:4186"
                     /db_xref="HPRD:03087"
                     /db_xref="MIM:601135"
     STS             1..1125
                     /gene="GBX2"
                     /db_xref="UniSTS:482687"
     exon            1..561
                     /gene="GBX2"
                     /inference="alignment:Splign:1.39.8"
     CDS             39..1085
                     /gene="GBX2"
                     /note="gastrulation brain homeo box 2; gastrulation and
                     brain-specific homeobox protein 2"
                     /codon_start=1
                     /product="homeobox protein GBX-2"
                     /protein_id="NP_001476.2"
                     /db_xref="GI:45593144"
                     /db_xref="CCDS:CCDS2515.1"
                     /db_xref="GeneID:2637"
                     /db_xref="HGNC:4186"
                     /db_xref="HPRD:03087"
                     /db_xref="MIM:601135"
                     /translation="
MSAAFPPSLMMMQRPLGSSTAFSIDSLIGSPPQPSPGHFVYTGYPMFMPYRPVVLPPPPPPPPALPQAALQPALPPAHPHHQIPSLPTGFCSSLAQGMALTSTLMATLPGGFSASPQHQEAAAARKFAPQPLPGGGNFDKAEALQADAEDGKGFLAKEGSLLAFSAAETVQASLVGAVRGQGKDESKVEDDPKGKEESFSLESDVDYSSDDNLTGQAAHKEEDPGHALEETPPSSGAAGSTTSTGKNRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRVKAGNANSKTGEPSRNPKIVVPIPVHVSRFAIRSQHQQLEQARP
"
     misc_feature    780..956
                     /gene="GBX2"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(780..794,798..800,849..851,867..869,906..908,
                     912..917,924..929,933..941,945..950)
                     /gene="GBX2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(786..788,795..797,915..917,924..929,936..938)
                     /gene="GBX2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     STS             39..1085
                     /gene="GBX2"
                     /db_xref="UniSTS:480910"
     variation       557
                     /gene="GBX2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112186240"
     exon            562..1335
                     /gene="GBX2"
                     /inference="alignment:Splign:1.39.8"
     STS             585..1239
                     /gene="GBX2"
                     /standard_name="GBX2_4093"
                     /db_xref="UniSTS:462895"
ORIGIN      
gacttttcgcctctcgctggcctctaccgagcgcgtctatgagcgcagcgttcccgccgtcgctgatgatgatgcagcgcccgctggggagtagcaccgccttcagcatagactcgctgatcggcagcccgccgcagcccagccccggccatttcgtctacaccggctaccccatgttcatgccctaccggccggtagtgctgccgccgccgccgccgccgccgcccgcgctgccccaggccgcgctgcagccagcgctgccgcccgcacaccctcaccaccagatccccagcctgcccacaggcttctgctccagcctggcgcagggcatggcgctcacctctacgctcatggccacgctccccggcggcttctccgcgtcgccccagcaccaggaggcggcagcggcccgcaagttcgcgccgcagccgctgcccggcggcggtaacttcgacaaggcggaggcgctgcaggctgacgcggaggacggcaaaggcttcctggccaaagagggctcgctgctcgccttctccgcggccgagacggtgcaggcttcgctcgtcggggctgtccgagggcaagggaaagacgagtcaaaggtggaagacgacccgaagggcaaggaggagagcttctcgctggagagcgatgtggactacagctcggatgacaatctgactggccaggcagctcacaaggaggaagacccgggccacgcgctggaggagaccccgccgagcagcggcgccgcgggcagcaccacgtctacgggcaagaaccggcggcggcggactgccttcaccagcgagcagctgctggagctagagaaggagttccactgcaaaaagtacctctccttgaccgagcgctcgcagatcgcccacgccctcaaactcagcgaggtgcaggtgaaaatctggttccagaaccgacgggccaagtggaaacgggtgaaggcaggcaatgccaattccaagacaggggagccctcccggaaccctaagatcgtcgtccccatccctgtccacgtcagcaggttcgctatcagaagtcagcatcagcagctagaacaggcccggccctgagggtccagaagggccagggcctggcacccacctggagaagcccccgcacccgagggaacccatggtggactccactgtgtttgaagcaacaaagtcacagcccagctgtggccatcccaagcaaattgagaatatattcactaaatgggcttaaaagactgcttttgaaggggcttacagccacaccagaagacacgctaaatatttattatactatcctactttgtacataaatatctctatagactgg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:2637 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:2637 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:2637 -> Biological process: GO:0001569 [patterning of blood vessels] evidence: IEA
            GeneID:2637 -> Biological process: GO:0001755 [neural crest cell migration] evidence: IEA
            GeneID:2637 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:2637 -> Biological process: GO:0007399 [nervous system development] evidence: TAS
            GeneID:2637 -> Biological process: GO:0007411 [axon guidance] evidence: IEA
            GeneID:2637 -> Biological process: GO:0021549 [cerebellum development] evidence: IEA
            GeneID:2637 -> Biological process: GO:0021555 [midbrain-hindbrain boundary morphogenesis] evidence: IEA
            GeneID:2637 -> Biological process: GO:0021568 [rhombomere 2 development] evidence: IEA
            GeneID:2637 -> Biological process: GO:0021794 [thalamus development] evidence: IEA
            GeneID:2637 -> Biological process: GO:0021884 [forebrain neuron development] evidence: IEA
            GeneID:2637 -> Biological process: GO:0021930 [cerebellar granule cell precursor proliferation] evidence: IEA
            GeneID:2637 -> Biological process: GO:0042472 [inner ear morphogenesis] evidence: IEA
            GeneID:2637 -> Biological process: GO:0048483 [autonomic nervous system development] evidence: IEA
            GeneID:2637 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.