2025-05-09 20:07:54, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001278633 2406 bp mRNA linear PRI 04-JUL-2013 DEFINITION Homo sapiens iroquois homeobox 4 (IRX4), transcript variant 2, mRNA. ACCESSION NM_001278633 VERSION NM_001278633.1 GI:520975442 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2406) AUTHORS Nguyen,H.H., Takata,R., Akamatsu,S., Shigemizu,D., Tsunoda,T., Furihata,M., Takahashi,A., Kubo,M., Kamatani,N., Ogawa,O., Fujioka,T., Nakamura,Y. and Nakagawa,H. TITLE IRX4 at 5p15 suppresses prostate cancer growth through the interaction with vitamin D receptor, conferring prostate cancer susceptibility JOURNAL Hum. Mol. Genet. 21 (9), 2076-2085 (2012) PUBMED 22323358 REMARK GeneRIF: the prostate cancer (PC)-susceptibility locus represented by rs12653946 at 5p15 is likely to regulate IRX4 expression in prostate which could suppress PC growth by interacting with the VDR pathway, conferring to PC susceptibility REFERENCE 2 (bases 1 to 2406) AUTHORS Cheng,Z., Wang,J., Su,D., Pan,H., Huang,G., Li,X., Li,Z., Shen,A., Xie,X., Wang,B. and Ma,X. TITLE Two novel mutations of the IRX4 gene in patients with congenital heart disease JOURNAL Hum. Genet. 130 (5), 657-662 (2011) PUBMED 21544582 REMARK GeneRIF: IRX4 had a potential causative impact on the development of congenital heart disease, particularly ventricular septal defect. REFERENCE 3 (bases 1 to 2406) AUTHORS Schurks,M., Buring,J.E., Ridker,P.M., Chasman,D.I. and Kurth,T. TITLE Genetic determinants of cardiovascular events among women with migraine: a genome-wide association study JOURNAL PLoS ONE 6 (7), E22106 (2011) PUBMED 21779381 REMARK GeneRIF: Among migraineurs with aura rs7698623 in MEPE (OR = 6.37; 95% CI 3.15-12.90; p = 2.7x10(-7)) and rs4975709 in IRX4 (OR = 5.06; 95% CI 2.66-9.62; p = 7.7x10(-7)) appeared to be associated with ischemic stroke. REFERENCE 4 (bases 1 to 2406) AUTHORS Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B, Yusuf S, Gerstein HC, Engert JC and Anand S. CONSRTM DREAM investigators TITLE Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study JOURNAL Diabetes Care 33 (10), 2250-2253 (2010) PUBMED 20628086 REMARK GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator) REFERENCE 5 (bases 1 to 2406) AUTHORS Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M, Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ, Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S, Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD, Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE and Hingorani AD. CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium TITLE Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip JOURNAL Am. J. Hum. Genet. 85 (5), 628-642 (2009) PUBMED 19913121 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 6 (bases 1 to 2406) AUTHORS Bayrak,F., Komurcu-Bayrak,E., Mutlu,B., Kahveci,G. and Erginel-Unaltuna,N. TITLE Genetic analysis of the Irx4 gene in hypertrophic cardiomyopathy JOURNAL Turk Kardiyol Dern Ars 36 (2), 90-95 (2008) PUBMED 18497553 REMARK GeneRIF: Polymorphism A381>G of the Irx4 gene may have a modifier effect on septal thickness, resulting in increased corrected QT dispersion and higher outflow gradients. GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 7 (bases 1 to 2406) AUTHORS Wang,G.F., Nikovits,W. Jr., Bao,Z.Z. and Stockdale,F.E. TITLE Irx4 forms an inhibitory complex with the vitamin D and retinoic X receptors to regulate cardiac chamber-specific slow MyHC3 expression JOURNAL J. Biol. Chem. 276 (31), 28835-28841 (2001) PUBMED 11382777 REFERENCE 8 (bases 1 to 2406) AUTHORS Bruneau,B.G., Bao,Z.Z., Tanaka,M., Schott,J.J., Izumo,S., Cepko,C.L., Seidman,J.G. and Seidman,C.E. TITLE Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand JOURNAL Dev. Biol. 217 (2), 266-277 (2000) PUBMED 10625552 REFERENCE 9 (bases 1 to 2406) AUTHORS Lewis,M.T., Ross,S., Strickland,P.A., Snyder,C.J. and Daniel,C.W. TITLE Regulated expression patterns of IRX-2, an Iroquois-class homeobox gene, in the human breast JOURNAL Cell Tissue Res. 296 (3), 549-554 (1999) PUBMED 10370142 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC025183.5, AB690779.1 and AI566193.1. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 4. Both variants 2 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AB690779.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025083, ERS025084 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-95 AC025183.5 13539-13633 96-2397 AB690779.1 96-2397 2398-2406 AI566193.1 1-9 c FEATURES Location/Qualifiers source 1..2406 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="5" /map="5p15.3" gene 1..2406 /gene="IRX4" /gene_synonym="IRXA3" /note="iroquois homeobox 4" /db_xref="GeneID:50805" /db_xref="HGNC:6129" /db_xref="MIM:606199" exon 1..118 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" exon 119..263 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" misc_feature 123..125 /gene="IRX4" /gene_synonym="IRXA3" /note="upstream in-frame stop codon" CDS 219..1856 /gene="IRX4" /gene_synonym="IRXA3" /note="isoform a is encoded by transcript variant 2; iroquois homeobox protein 4; homeodomain protein IRXA3" /codon_start=1 /product="iroquois-class homeodomain protein IRX-4 isoform a" /protein_id="NP_001265562.1" /db_xref="GI:520975443" /db_xref="GeneID:50805" /db_xref="HGNC:6129" /db_xref="MIM:606199" /translation="
MSYPQFGYPYSSAPQFLMATNSLSTCCESGGRTLADSGPAASAQAPVYCPVYESRLLATARHELNSAAALGVYGGPYGGSQGYGNYVTYGSEASAFYSLNSFDSKDGSGSAHGGLAPAAAAYYPYEPALGQYPYDRIKRLGGHPHKGIGLDLSGLGRSPGSLYGTMDSGTRRKNATRETTSTLKAWLQEHRKNPYPTKGEKIMLAIITKMTLTQVSTWFANARRRLKKENKMTWPPRNKCADEKRPYAEGEEEEGGEEEAREEPLKSSKNAEPVGKEEKELELSDLDDFDPLEAEPPACELKPPFHSLDGGLERVPAAPDGPVKEASGALRMSLAAGGGAALDEDLERARSCLRSAAAGPEPLPGAEGGPQVCEAKLGFVPAGASAGLEAKPRIWSLAHTATAAAAAATSLSQTEFPSCMLKRQGPAAPAAVSSAPATSPSVALPHSGALDRHQDSPVTSLRNWVDGVFHDPILRHSTLNQAWATAKGALLDPGPLGRSLGAGANVLTAPLARAFPPAVPQDAPAAGAARELLALPKAGGKPFCA
" exon 264..515 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" exon 516..625 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" exon 626..703 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" exon 704..1032 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" STS 779..843 /gene="IRX4" /gene_synonym="IRXA3" /standard_name="Irx3" /db_xref="UniSTS:498475" exon 1033..2398 /gene="IRX4" /gene_synonym="IRXA3" /inference="alignment:Splign:1.39.8" ORIGIN
aggtgctccgcctggaaatgtctccattagttgtcgccggctccccgctggagcgcgcgcgccgagcttccgcgcggagccctcgcgggctgccgggagcggcccagcgccaccgcagcgcctagaagcctgcagctccggagcagtggccgcgccacgccggccccagcgcgcagaaccctgcaggccccgcccgtccgccccgggccgcgcccgccatgtcctacccgcagtttggatacccctactcctcggctccccagttcttgatggccaccaactccctgagcacgtgctgcgagtccggaggccgcacgctggcggactccgggcccgccgcctcggcccaggcgccggtctactgcccggtctacgagagccggctgctggccaccgcgcgccacgagctcaactcggccgcggcgctgggcgtctatgggggtccctatggcggatcgcagggctatggcaactacgtgacctacggctcggaggcgtccgccttctactcgctgaacagctttgattccaaggatggttcgggatctgcgcatgggggcctggcaccagccgctgccgcctactacccttacgagccagctctgggccagtacccctatgacaggatcaaacggctaggcggtcatccccataaaggaattggcctggacctctctggcttgggaaggagcccaggctccctgtatggaaccatggacagcggcacgcggcgcaagaacgccacgcgcgagaccaccagcacgctcaaggcctggctgcaggagcaccgcaagaacccctaccccaccaagggcgagaagatcatgctggccatcatcaccaagatgaccctcacacaggtctccacctggttcgccaacgcgcgccggcgcctcaagaaggagaacaagatgacgtggccgccgcggaacaagtgcgcagacgagaagcggccctacgcggagggcgaggaggaggaggggggcgaggaggaggcgcgggaggagcccctcaagagctccaagaacgcagagcccgtgggcaaagaggagaaggagctggagcttagtgacttggacgacttcgacccgctggaagcagagccgccggcgtgcgagctgaagccgcccttccactccctggacggcggtctggagcgcgtccccgccgcgcccgacggcccggtcaaggaggcctcaggcgcgctccggatgtctctggccgcgggtggcggagctgctctggacgaggacctggagagggcccggagctgtctccgcagcgcggcggccgggccggagccactgccgggcgcagagggcggccctcaggtctgcgaggccaagctggggtttgtgccggcgggggcgtcggcaggcctggaggctaagccgcgcatctggtccctggcccacacagccaccgccgccgccgccgccgccacctccctgagccagactgagtttccgtcgtgcatgctcaagcgccaaggtcccgcggcccctgcggctgtgtcctccgcgcccgccacgtccccgtctgtggcccttccccactctggcgccctggacaggcaccaggactccccggtaaccagtctcagaaactgggtggacggggtcttccacgaccccatcctcaggcacagcactttgaaccaggcctgggccaccgccaagggcgccctcctggaccccgggcctctgggacgctcgctgggggcgggcgcgaacgtgctgactgcacccctggcccgcgcctttccgcctgccgtgccccaggacgccccagctgcaggcgccgccagggagctgctcgccctgcccaaggccggcggcaaacccttctgcgcctgaggcgggcgggtcccgagcccaggagggaacccgcgctcaggcggacggcgccgactcttttcactgagtttccagaggaagactagcgcggccaccgcgaagccgccaacccaccggagagggggcttctgaacttggactcctgggaacatggacaagcccggcgctgccacgccggggcctccaccgcctgggcctgagcctgaccgggccattcccaaatttgggacgcggaaggagaggctctcggagcagaagaggccagataccctgaagcataaagtttacgtcaaaagtttacatggagaaggcggttccgttctgaagcgtggtctgctgtcccctgggcgtgaggcctcctgggcctgtcgggcctccgatttcatcctcagcacgtaatgctcaccaacagcacttgcactgagttgactcttgcacactcttgactccataatatgatgctttttaagatgtatgttcacaccaataattgcctgcttcagaggctaatataacaaaaccaataaaaccgagtgatggtgaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:50805 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:50805 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:50805 -> Biological process: GO:0007507 [heart development] evidence: IEA GeneID:50805 -> Biological process: GO:0048561 [establishment of organ orientation] evidence: IEA GeneID:50805 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.