GGRNA Home | Help | Advanced search

2025-05-09 20:16:23, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001278056            1380 bp    mRNA    linear   PRI 07-MAY-2013
DEFINITION  Homo sapiens double homeobox protein 4-like (LOC100653046), mRNA.
ACCESSION   NM_001278056
VERSION     NM_001278056.1  GI:489406923
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1380)
  AUTHORS   Dixit,M., Ansseau,E., Tassin,A., Winokur,S., Shi,R., Qian,H.,
            Sauvage,S., Matteotti,C., van Acker,A.M., Leo,O., Figlewicz,D.,
            Barro,M., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Chen,Y.W.
  TITLE     DUX4, a candidate gene of facioscapulohumeral muscular dystrophy,
            encodes a transcriptional activator of PITX1
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 104 (46), 18157-18162 (2007)
   PUBMED   17984056
REFERENCE   2  (bases 1 to 1380)
  AUTHORS   Clapp,J., Mitchell,L.M., Bolland,D.J., Fantes,J., Corcoran,A.E.,
            Scotting,P.J., Armour,J.A. and Hewitt,J.E.
  TITLE     Evolutionary conservation of a coding function for D4Z4, the tandem
            DNA repeat mutated in facioscapulohumeral muscular dystrophy
  JOURNAL   Am. J. Hum. Genet. 81 (2), 264-279 (2007)
   PUBMED   17668377
REFERENCE   3  (bases 1 to 1380)
  AUTHORS   Kowaljow,V., Marcowycz,A., Ansseau,E., Conde,C.B., Sauvage,S.,
            Matteotti,C., Arias,C., Corona,E.D., Nunez,N.G., Leo,O.,
            Wattiez,R., Figlewicz,D., Laoudj-Chenivesse,D., Belayew,A.,
            Coppee,F. and Rosa,A.L.
  TITLE     The DUX4 gene at the FSHD1A locus encodes a pro-apoptotic protein
  JOURNAL   Neuromuscul. Disord. 17 (8), 611-623 (2007)
   PUBMED   17588759
REFERENCE   4  (bases 1 to 1380)
  AUTHORS   Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A.,
            Frants,R.R., Collen,D. and Belayew,A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   5  (bases 1 to 1380)
  AUTHORS   Lee,J.H., Goto,K., Matsuda,C. and Arahata,K.
  TITLE     Characterization of a tandemly repeated 3.3-kb KpnI unit in the
            facioscapulohumeral muscular dystrophy (FSHD) gene region on
            chromosome 4q35
  JOURNAL   Muscle Nerve Suppl 2, S6-S13 (1995)
   PUBMED   7739628
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC215524.3.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data because no transcript was available for this gene. The genomic
            coordinates used for the transcript record were based on literature
            reports indicating transcription of the double homeobox protein
            4-like gene copies, e.g., PMID:17588759.
            COMPLETENESS: complete on the 5' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1380              AC215524.3         29500-30879         c
FEATURES             Location/Qualifiers
     source          1..1380
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4"
     gene            1..1380
                     /gene="LOC100653046"
                     /note="double homeobox protein 4-like"
                     /db_xref="GeneID:100653046"
     exon            1..1380
                     /gene="LOC100653046"
                     /inference="alignment:Splign:1.39.8"
     CDS             98..1372
                     /gene="LOC100653046"
                     /note="double homeobox protein 4-like protein 4-like"
                     /codon_start=1
                     /product="double homeobox protein 4-like"
                     /protein_id="NP_001264985.1"
                     /db_xref="GI:489406924"
                     /db_xref="GeneID:100653046"
                     /translation="
MALPTPSDSTLPAEARGRGRRRRLVWTPSQSEALRACFERNPYPGIATRERLAQAIGIPEPRVQIWFQNERSRQLRQHRRESRPWPGRRGPPEGRRKRTAVTGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHPGQGGRAPAQAGGLCSAAPGGGHPAPSWVAFAHTGAWGTGLPAPHVPCAPGALPQGAFVSQAARAAPALQPSQAAPAEGISQPAPARGDFAYAAPAPPDGALSHPQAPRWPPHPGKSREDRDPQRDGLPGPCAVAQPGPAQAGPQGQGVLAPPTSQGSPWWGWGRGPQVAGAAWEPQAGAAPPPQPAPPDASASARQGQMQGIPAPSQALQEPAPWSALPCGLLLDELLASPEFLQQAQPLLETEAPGELEASEEAASLEAPLSEEEYRALLEEL
"
     misc_feature    170..331
                     /gene="LOC100653046"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(170..172,290..292,299..304,311..313)
                     /gene="LOC100653046"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    order(173..175,224..226,242..244,281..283,287..292,
                     299..304,308..316,320..325)
                     /gene="LOC100653046"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    401..544
                     /gene="LOC100653046"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(449..451,467..469,506..508,512..517,524..529,
                     533..541)
                     /gene="LOC100653046"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(515..517,524..529,536..538)
                     /gene="LOC100653046"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
acctgccgcagtgcacagtccggctgaggtgcacgggagcccgccggcctctctctgcccgcgtccgtccgtgaaattccggccggggctcaccgcgatggccctcccgacaccctcggacagcaccctccccgcggaagcccggggacgaggacggcgacggagactcgtttggaccccgagccaaagcgaggccctgcgagcctgctttgagcggaacccgtacccgggcatcgccaccagagaacggctggcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaggcagcaccggcgggaatctcggccctggcccgggagacgcggcccgccagaaggccggcgaaagcggaccgccgtcaccggatcccagaccgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccgcccgggaggagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacagggtggcagggcgcccgcgcaggcaggcggcctgtgcagcgcggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagaggggatctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcacccgggcaaaagccgggaggaccgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggg
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.